ID: 1137003834

View in Genome Browser
Species Human (GRCh38)
Location 16:35254358-35254380
Sequence TTGAGCTACCACTTATAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137003834_1137003838 21 Left 1137003834 16:35254358-35254380 CCCACTTATAAGTGGTAGCTCAA No data
Right 1137003838 16:35254402-35254424 GAGACTGGAAGAATACACACTGG No data
1137003834_1137003836 -7 Left 1137003834 16:35254358-35254380 CCCACTTATAAGTGGTAGCTCAA No data
Right 1137003836 16:35254374-35254396 AGCTCAATAATACATACACTTGG No data
1137003834_1137003837 6 Left 1137003834 16:35254358-35254380 CCCACTTATAAGTGGTAGCTCAA No data
Right 1137003837 16:35254387-35254409 ATACACTTGGATATAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137003834 Original CRISPR TTGAGCTACCACTTATAAGT GGG (reversed) Intergenic
No off target data available for this crispr