ID: 1137009106

View in Genome Browser
Species Human (GRCh38)
Location 16:35306144-35306166
Sequence CCATTTTGAGAGAAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137009104_1137009106 -5 Left 1137009104 16:35306126-35306148 CCAGAGATATGTCAGTATCCATT No data
Right 1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG No data
1137009103_1137009106 16 Left 1137009103 16:35306105-35306127 CCACATTACGTGAATGCTGGGCC No data
Right 1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG No data
1137009100_1137009106 29 Left 1137009100 16:35306092-35306114 CCAGAAAGGAGAGCCACATTACG No data
Right 1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137009106 Original CRISPR CCATTTTGAGAGAAGAGCCC TGG Intergenic
No off target data available for this crispr