ID: 1137017525

View in Genome Browser
Species Human (GRCh38)
Location 16:35392741-35392763
Sequence GAGTGTGGCCTGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137017525_1137017529 -7 Left 1137017525 16:35392741-35392763 CCTTCCACATTCAGGCCACACTC No data
Right 1137017529 16:35392757-35392779 CACACTCTCACCAACTTCCAGGG No data
1137017525_1137017528 -8 Left 1137017525 16:35392741-35392763 CCTTCCACATTCAGGCCACACTC No data
Right 1137017528 16:35392756-35392778 CCACACTCTCACCAACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137017525 Original CRISPR GAGTGTGGCCTGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr