ID: 1137019291

View in Genome Browser
Species Human (GRCh38)
Location 16:35407503-35407525
Sequence CTTATTGAGGCCCTAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137019291_1137019294 5 Left 1137019291 16:35407503-35407525 CCACTCATTAGGGCCTCAATAAG No data
Right 1137019294 16:35407531-35407553 TTTCTGGCTGTCGTTTTACTAGG No data
1137019291_1137019296 24 Left 1137019291 16:35407503-35407525 CCACTCATTAGGGCCTCAATAAG No data
Right 1137019296 16:35407550-35407572 TAGGGACCTAAACACAGTTAAGG No data
1137019291_1137019298 26 Left 1137019291 16:35407503-35407525 CCACTCATTAGGGCCTCAATAAG No data
Right 1137019298 16:35407552-35407574 GGGACCTAAACACAGTTAAGGGG No data
1137019291_1137019297 25 Left 1137019291 16:35407503-35407525 CCACTCATTAGGGCCTCAATAAG No data
Right 1137019297 16:35407551-35407573 AGGGACCTAAACACAGTTAAGGG No data
1137019291_1137019295 6 Left 1137019291 16:35407503-35407525 CCACTCATTAGGGCCTCAATAAG No data
Right 1137019295 16:35407532-35407554 TTCTGGCTGTCGTTTTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137019291 Original CRISPR CTTATTGAGGCCCTAATGAG TGG (reversed) Intergenic
No off target data available for this crispr