ID: 1137021924

View in Genome Browser
Species Human (GRCh38)
Location 16:35436566-35436588
Sequence GTTTATGTATGTTCATCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137021924_1137021927 30 Left 1137021924 16:35436566-35436588 CCTAAAGATGAACATACATAAAC No data
Right 1137021927 16:35436619-35436641 TATACCTCAAAGTCAGCTTCTGG No data
1137021924_1137021925 5 Left 1137021924 16:35436566-35436588 CCTAAAGATGAACATACATAAAC No data
Right 1137021925 16:35436594-35436616 AATCCAACAATTCTACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137021924 Original CRISPR GTTTATGTATGTTCATCTTT AGG (reversed) Intergenic
No off target data available for this crispr