ID: 1137021927

View in Genome Browser
Species Human (GRCh38)
Location 16:35436619-35436641
Sequence TATACCTCAAAGTCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137021924_1137021927 30 Left 1137021924 16:35436566-35436588 CCTAAAGATGAACATACATAAAC No data
Right 1137021927 16:35436619-35436641 TATACCTCAAAGTCAGCTTCTGG No data
1137021926_1137021927 -1 Left 1137021926 16:35436597-35436619 CCAACAATTCTACTCTTAGGTGT No data
Right 1137021927 16:35436619-35436641 TATACCTCAAAGTCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137021927 Original CRISPR TATACCTCAAAGTCAGCTTC TGG Intergenic
No off target data available for this crispr