ID: 1137022973

View in Genome Browser
Species Human (GRCh38)
Location 16:35448930-35448952
Sequence GGGTCATCATTCAGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137022973_1137022979 20 Left 1137022973 16:35448930-35448952 CCACATCACCTGAATGATGACCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1137022979 16:35448973-35448995 TTTGAGAGAAGAGCCCTGGCAGG No data
1137022973_1137022978 16 Left 1137022973 16:35448930-35448952 CCACATCACCTGAATGATGACCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137022973 Original CRISPR GGGTCATCATTCAGGTGATG TGG (reversed) Intergenic
900479015 1:2889380-2889402 GGGCCTTGATTCAGGTGCTGGGG + Intergenic
901290002 1:8116671-8116693 GTGTCATCATCCAGGTTGTGGGG - Intergenic
906659348 1:47571488-47571510 GGGGCATCACTCAGTTGGTGAGG + Intergenic
908586417 1:65574979-65575001 AGTTCCTCATTCAGTTGATGGGG + Intronic
918232994 1:182552691-182552713 GGCTCATGATTCAGGGGACGGGG + Intronic
924553014 1:245095826-245095848 GGGTCACCTTTAAAGTGATGGGG + Intronic
1063640564 10:7826169-7826191 GGCTCATCATTTAGGTGCTCTGG + Intronic
1070426515 10:76293514-76293536 GTGGCATCATACAGGTGATTTGG + Intronic
1075783449 10:125032326-125032348 GGGTCACCATGGAGGTGAGGTGG - Intronic
1089096738 11:115925830-115925852 GCCACATCATTCAGGTCATGGGG - Intergenic
1090656139 11:128847175-128847197 TGGGCATGTTTCAGGTGATGCGG - Intronic
1096080903 12:48831834-48831856 GGGTCTTCATCCTGGTGAGGTGG - Intronic
1100441624 12:94622536-94622558 GGGTTATCATTAAGGTCATAGGG - Intronic
1102623820 12:114218619-114218641 GGGTCCTCATTTAGTTGTTGTGG - Intergenic
1105785345 13:23742829-23742851 GGGTCTTCACTGGGGTGATGGGG + Intronic
1106760294 13:32861136-32861158 AGGTGGTCATTCAGGTGAAGAGG - Intergenic
1107824963 13:44320433-44320455 GGGTAGTCATTCAAGTGATGTGG + Intergenic
1110157305 13:72333563-72333585 GGGTGATTATTCAGGTGAAATGG - Intergenic
1111515253 13:89322576-89322598 GTGTCATCATTGATGTCATGGGG + Intergenic
1113412284 13:110100906-110100928 GGGTCATCGTCAAGGAGATGGGG - Intergenic
1122937811 14:104967990-104968012 GTGTCATGATTCAGGTGATGGGG - Intronic
1202868981 14_GL000225v1_random:142033-142055 CCCTCATCATCCAGGTGATGGGG + Intergenic
1125432491 15:39609530-39609552 GGGTCACCATGCAGCTGCTGGGG - Intronic
1129883008 15:79019337-79019359 GGGTCATTATTCAGATTAGGGGG - Intronic
1132633143 16:929368-929390 GGGTCCACACTCAGGGGATGGGG + Intronic
1133700557 16:8304556-8304578 GAGTCATCATTTAGGTGTTTGGG - Intergenic
1137008764 16:35302887-35302909 GGCCCAGCATTCAGGTGATGTGG - Intergenic
1137022973 16:35448930-35448952 GGGTCATCATTCAGGTGATGTGG - Intergenic
1141998348 16:87648875-87648897 AGGTCAGCATGCAGGTGCTGGGG - Intronic
1143026084 17:3942711-3942733 AGGTCATCAAGCAGCTGATGCGG - Exonic
1145849222 17:28075197-28075219 GACTCAGCATTCAGGTGATTTGG + Intronic
1147030936 17:37635591-37635613 AGTTCATCATTCACCTGATGAGG + Intronic
1147753960 17:42755896-42755918 GTGCCATCATTCTGGAGATGAGG + Intergenic
1148835006 17:50461357-50461379 CGGGCATCATTCTGGTGAGGAGG + Exonic
1155703833 18:28782920-28782942 GTGTCATAATGCAGGTGCTGTGG + Intergenic
1156732400 18:40210184-40210206 GGATCCTCATTAAGTTGATGTGG + Intergenic
1159021218 18:63144806-63144828 GGGTCTTCTTTCTGTTGATGTGG - Intronic
1159499035 18:69245040-69245062 ATGTCATCATCCAGGTGGTGGGG + Intergenic
1159941484 18:74412228-74412250 GGGTCATCAATCAGATGAAATGG - Intergenic
1159977120 18:74727749-74727771 GATTCATCCTGCAGGTGATGGGG + Intronic
1164283157 19:23787030-23787052 GGCCCAGCATCCAGGTGATGTGG + Intronic
1164918372 19:32070183-32070205 GGTTCATCATGCGGGAGATGGGG + Intergenic
1167297048 19:48657032-48657054 GGGTCATGAATCAGGCAATGTGG + Intergenic
927657002 2:24957500-24957522 GGGGCATTAATTAGGTGATGTGG - Intronic
930500494 2:52210720-52210742 TGGACATCATTCAGATGATGGGG - Intergenic
931819584 2:65937867-65937889 AGCTCATCATTCAGTTGATCAGG - Intergenic
934682549 2:96295479-96295501 GGCTCATCATTCTGGTGAGTTGG - Exonic
935413284 2:102788238-102788260 GGGTCCTCATTCAGCTGGTCTGG + Intronic
937390476 2:121481635-121481657 GGGTCACCTTACAGGTGATTTGG + Intronic
940982748 2:160021676-160021698 TGTTCACCATCCAGGTGATGGGG + Intronic
944474385 2:200088775-200088797 GGGTAATCATTCAGATGATAAGG - Intergenic
946168058 2:217877438-217877460 GGGTCTTCATCCAGGAAATGGGG + Intronic
1172441328 20:34968652-34968674 GGGTCACCATCCAGATAATGTGG - Intergenic
1178065842 21:28903539-28903561 GGTTCATGTTGCAGGTGATGAGG + Intergenic
1179285709 21:39975824-39975846 GGGTCAGCAGTGAAGTGATGGGG + Intergenic
1179551666 21:42147319-42147341 AAGTCATCATTCAGCTAATGAGG + Intergenic
1180957729 22:19748400-19748422 GGGTCATTGTGCAGGTGCTGAGG - Intergenic
1183163151 22:36128244-36128266 GTGGCATCATTAATGTGATGTGG - Intergenic
1184652262 22:45924788-45924810 GGCTCATCAGGCAGGTGCTGGGG + Intronic
949287226 3:2421146-2421168 TGGTGGTCATTAAGGTGATGGGG - Intronic
952652731 3:35745886-35745908 GGGTCATTTTTGCGGTGATGTGG - Intronic
955056642 3:55461090-55461112 GGGCACTCATTTAGGTGATGAGG - Intergenic
955407969 3:58637426-58637448 GGGAACTCATCCAGGTGATGTGG + Intronic
960497731 3:118395075-118395097 GGGTCTGCATTCAAGAGATGAGG + Intergenic
961364882 3:126393240-126393262 GGGTGATCATGCAGGTGAAATGG + Intergenic
961748493 3:129081429-129081451 GGGTCAGCACTCAGATGCTGCGG + Intergenic
962164210 3:133032168-133032190 GGTTCTTCATACAGGTGAAGTGG + Intergenic
962289216 3:134117626-134117648 TGTTCACTATTCAGGTGATGTGG - Intronic
963398504 3:144765128-144765150 GGGTCATCATTGAGCTGAATGGG + Intergenic
964240863 3:154593094-154593116 GGTTCATGATGCAGGTGATGAGG - Intergenic
966801532 3:183768605-183768627 GGGTCATCCTCCCAGTGATGTGG - Intronic
968898763 4:3420761-3420783 GTGTCATCAGTCAGCTGGTGGGG - Intronic
979382290 4:120021091-120021113 GGATCAGCATCCAGGGGATGTGG + Intergenic
984342089 4:178470137-178470159 GGGTCAGTATTCAGGGGATCGGG + Intergenic
986275926 5:6274949-6274971 GGGACATCACTCAAGTGTTGAGG + Intergenic
995658855 5:114458666-114458688 GGGTCATAAGACAGGTAATGTGG - Intronic
996785471 5:127232255-127232277 TGGTTACCATTCAGGTGAGGTGG + Intergenic
997352001 5:133237442-133237464 GGGCAATCACTCAGGTGCTGAGG + Intronic
998846869 5:146318877-146318899 TGTTCATTATTCAGGTGATGAGG - Intronic
999079230 5:148827283-148827305 GGGTGATCATTCTGATGGTGTGG + Exonic
1001969520 5:175943431-175943453 GGGGCAGCACGCAGGTGATGAGG + Intronic
1002247915 5:177900322-177900344 GGGGCAGCACGCAGGTGATGAGG - Intergenic
1005606411 6:27482324-27482346 TGGTCAAAATTCAAGTGATGAGG + Intergenic
1017070505 6:150571791-150571813 GGGCCACCATGCAGGTGTTGGGG - Intergenic
1017204041 6:151786018-151786040 GCGTCACCATTCAGGTGAGTGGG + Intronic
1018712875 6:166509233-166509255 GGGTCACCACTGAGGTGATGTGG + Intronic
1018942163 6:168315782-168315804 TGGTCATCATTCAGGTGTGAAGG - Intronic
1021625315 7:22587192-22587214 TGGTAATCATGCAGGTGATTGGG - Intronic
1023324187 7:39034741-39034763 TGATCATAATTGAGGTGATGTGG + Intronic
1025156655 7:56613199-56613221 GGCCCAGCATTTAGGTGATGTGG - Intergenic
1025160890 7:56659624-56659646 GGCTCAGTATTCAGGTGATGTGG + Intergenic
1025750305 7:64288359-64288381 GGCTCAGTATTCAGGTGATGTGG - Intergenic
1025760229 7:64382543-64382565 GGCCCAGCATTTAGGTGATGTGG + Intergenic
1027742670 7:82031267-82031289 GGGACATCTTCCAGGTGGTGAGG + Intronic
1031041880 7:116847011-116847033 GGGGTCTCAGTCAGGTGATGAGG - Intronic
1036713596 8:11099793-11099815 AGGTCATGATGGAGGTGATGAGG + Intronic
1036983605 8:13499816-13499838 GGGTCATCTTTCAAAGGATGTGG - Exonic
1039143086 8:34415389-34415411 ATCTCATCCTTCAGGTGATGAGG + Intergenic
1040357885 8:46637304-46637326 GGTCCAGCATTTAGGTGATGTGG + Intergenic
1040371353 8:46778964-46778986 GGCCCAGCATTTAGGTGATGTGG + Intergenic
1040378545 8:46850008-46850030 GGCCCAGCATTTAGGTGATGTGG + Intergenic
1046395438 8:113633480-113633502 GGGCCATGAGCCAGGTGATGGGG - Intergenic
1048635737 8:136293285-136293307 GAGTCATTACTCAGGTGATCAGG + Intergenic
1052481167 9:29028344-29028366 AGGGTTTCATTCAGGTGATGAGG + Intergenic
1055684569 9:78757241-78757263 GATTCATCATGCAGGAGATGGGG + Intergenic
1056658033 9:88524875-88524897 GGGTCAGCAGTCAGGTGTTTCGG + Intergenic
1057440663 9:95080785-95080807 GTGTCATCTTTCAGCAGATGGGG + Intronic
1057576146 9:96244282-96244304 TTGTCATCATCCAGGTGAGGTGG - Intronic
1057576153 9:96244320-96244342 AAGTCATCATCCAGGTGAGGTGG - Exonic
1062310965 9:135936936-135936958 GGGTCAGCATCCAGGAGGTGAGG + Intronic
1203735897 Un_GL000216v2:139109-139131 CCCTCATCATCCAGGTGATGGGG - Intergenic
1186160835 X:6775671-6775693 GGGACATGATCTAGGTGATGAGG + Intergenic
1186526626 X:10255110-10255132 GAGTAATCATTAAGGTGAGGAGG - Intergenic
1187986370 X:24816821-24816843 GTGTCATCATTCATATGAGGGGG - Intronic
1193037016 X:76962344-76962366 TGTACACCATTCAGGTGATGGGG - Intergenic
1195168713 X:102245569-102245591 GTGTCATCTTTCAGTAGATGGGG - Intergenic
1195190144 X:102441518-102441540 GTGTCATCTTTCAGTAGATGGGG + Intronic
1199582515 X:149374427-149374449 GGGTCATTTGTCAGGTGATTGGG + Intergenic
1199765310 X:150936948-150936970 GGGTCAGGGTTCAGGTGAGGAGG + Intergenic
1200341427 X:155400966-155400988 GGGTCTTCTATCAAGTGATGGGG + Intergenic
1200770670 Y:7122465-7122487 GAGTCATAATTCAAGTAATGTGG + Intergenic
1200866282 Y:8047122-8047144 GGCTCAGGATTTAGGTGATGTGG + Intergenic
1200901928 Y:8441409-8441431 AGCTCAGCATTTAGGTGATGTGG - Intergenic
1202246052 Y:22821456-22821478 GGCCCAGCATTTAGGTGATGTGG + Intergenic
1202262345 Y:22982872-22982894 GGCTCATGGTTTAGGTGATGTGG + Intronic
1202264348 Y:23002294-23002316 GGCCCAGCATTTAGGTGATGTGG + Intronic
1202399040 Y:24455204-24455226 GGCCCAGCATTTAGGTGATGTGG + Intergenic
1202415335 Y:24616613-24616635 GGCTCATGGTTTAGGTGATGTGG + Intronic
1202417339 Y:24636036-24636058 GGCCCAGCATTTAGGTGATGTGG + Intronic
1202453447 Y:25034050-25034072 GGCCCAGCATTTAGGTGATGTGG - Intronic
1202455452 Y:25053473-25053495 GGCTCATGGTTTAGGTGATGTGG - Intronic
1202471740 Y:25214882-25214904 GGCCCAGCATTTAGGTGATGTGG - Intergenic
1202625023 Y:56848312-56848334 CCCTCATCATCCAGGTGATGGGG + Intergenic