ID: 1137022974

View in Genome Browser
Species Human (GRCh38)
Location 16:35448938-35448960
Sequence ATATCTCTGGGTCATCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137022974_1137022979 12 Left 1137022974 16:35448938-35448960 CCTGAATGATGACCCAGAGATAT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1137022979 16:35448973-35448995 TTTGAGAGAAGAGCCCTGGCAGG No data
1137022974_1137022982 29 Left 1137022974 16:35448938-35448960 CCTGAATGATGACCCAGAGATAT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1137022982 16:35448990-35449012 GGCAGGAAAGTCACATGACCTGG 0: 1
1: 3
2: 22
3: 259
4: 2216
1137022974_1137022978 8 Left 1137022974 16:35448938-35448960 CCTGAATGATGACCCAGAGATAT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137022974 Original CRISPR ATATCTCTGGGTCATCATTC AGG (reversed) Intergenic
902162072 1:14538818-14538840 AAATATCTGGGCTATCATTCTGG - Intergenic
903742090 1:25564133-25564155 AAGTCTCTGGGTCCTCATTCAGG - Intronic
906031851 1:42727579-42727601 AGATTTCTGGGTCTTCAGTCAGG - Intergenic
907511144 1:54961020-54961042 AAATTTCTGAGTCATCATTTTGG + Intergenic
907721813 1:56979051-56979073 ATTTCCCTGAGTAATCATTCTGG + Intergenic
909208166 1:72788330-72788352 ATATCTCTGGATTCTAATTCTGG - Intergenic
909247211 1:73301347-73301369 ATATCTCTGAGTCATCACATGGG - Intergenic
910125719 1:83839878-83839900 AAATCTATGTGTCATTATTCAGG - Intergenic
910501514 1:87896936-87896958 ATATATCTTGGTCAAGATTCAGG + Intergenic
911762298 1:101630280-101630302 AGCTCTCTGGGTAATCCTTCTGG - Intergenic
912363338 1:109113015-109113037 AAATTTCTGGGTCATCTTTCAGG - Intronic
916670525 1:167014711-167014733 ATTTCTCTGAGTCACTATTCAGG - Intronic
917209605 1:172618033-172618055 AAATTTCTGAGTCATCATTTTGG + Intergenic
917298880 1:173551531-173551553 ATATCTCTGTGTCTACATTTTGG + Intronic
917556794 1:176098700-176098722 AAATTTCTGAGTCATCATTTTGG + Intronic
919494474 1:198247304-198247326 ATATCTGTGGATCATCATGTAGG + Intronic
919900769 1:202042732-202042754 CTATCTCTGGGGCAACATTTTGG - Intergenic
921354442 1:214273279-214273301 AGATCTCTGGGTCATCACAATGG + Intergenic
922977463 1:229797606-229797628 TTATATCTGGGAGATCATTCAGG + Intergenic
923412995 1:233728481-233728503 AAATTTCTGAGTCATCATTTTGG - Intergenic
924030587 1:239881477-239881499 ATGTACCTGGGTTATCATTCAGG + Intronic
924296821 1:242595959-242595981 AAATTTCTGAGTCATCATTTTGG + Intergenic
924770531 1:247076126-247076148 ACATCTCTGGGTCAAGAGTCAGG + Intronic
924811356 1:247405341-247405363 ATGTATTTGGCTCATCATTCGGG + Intergenic
1063099710 10:2938801-2938823 ATCTCACTGGGTCTCCATTCTGG - Intergenic
1063322863 10:5068458-5068480 AAATTTCTGAGTCATCATTTTGG - Intronic
1064713654 10:18152673-18152695 ACAACTCTGAGTCATCATGCAGG + Intronic
1065151663 10:22828947-22828969 AAATTTCTGAGTCATCATTTTGG - Intergenic
1067401882 10:45983372-45983394 ATGTATCTGGCTCATCATTTCGG - Intronic
1067464080 10:46481553-46481575 ATATTTTTGAGTCATCATTTTGG + Intergenic
1067464239 10:46484529-46484551 ATATGTCTTAGTCATAATTCTGG + Intergenic
1067622956 10:47900125-47900147 ATATGTCTTAGTCATAATTCTGG - Intergenic
1067623115 10:47903098-47903120 ATATTTTTGAGTCATCATTTTGG - Intergenic
1068379911 10:56238743-56238765 ATATTTCTAGGTAATCATTATGG + Intergenic
1068464423 10:57370113-57370135 ATATTTCTGGTTCATTATTTAGG + Intergenic
1068743135 10:60497801-60497823 ATATCTCTGTGTTATCATCTAGG - Intronic
1073213721 10:101825032-101825054 CTTTCTCTGGGTCACCATTATGG - Intergenic
1073574394 10:104609914-104609936 AAATTTCTGAGTCATCATTTTGG + Intergenic
1075462322 10:122625215-122625237 ATTTCTCTCGCTCATCATCCTGG + Intronic
1077471724 11:2766248-2766270 AAATCTATGGGTCAGCAATCTGG + Intronic
1079001236 11:16758610-16758632 ATCTCTCTGGGTCTCCTTTCTGG + Intergenic
1080397857 11:31906489-31906511 ATTTCTTTGGGTCATGGTTCTGG + Intronic
1080559927 11:33453595-33453617 ATCTTTCTGGGTCACCTTTCTGG + Intergenic
1081241500 11:40711658-40711680 ATTTCTCTGGTTCTTTATTCAGG - Intronic
1082656095 11:55858657-55858679 AAATTTCTGAGTCATCATTTTGG + Intergenic
1083376519 11:62227489-62227511 AGATTTCTGAGTCATCATTTTGG + Intergenic
1086296168 11:85370586-85370608 AAATTTCTGAGTCATCATTTTGG + Intronic
1089775181 11:120830960-120830982 ATGTCTCAGTGACATCATTCTGG + Intronic
1092585982 12:9901773-9901795 AAATTTCTGAGTCATCATTTTGG - Intronic
1094316574 12:29142358-29142380 AAATTTCTGAGTCATCATTTTGG - Intergenic
1094374960 12:29780347-29780369 ATGTCTCTGGATCTTCATTCAGG - Intronic
1095355270 12:41265795-41265817 ATATTTATGGCACATCATTCTGG - Intronic
1095980394 12:47970421-47970443 CGATCTCTGGGTCATCTCTCAGG + Intergenic
1097500058 12:60390774-60390796 AAATTTCTGAGTCATCATTTTGG - Intergenic
1097601414 12:61697427-61697449 AAATTTCTGAGTCATCATTTTGG + Intergenic
1097991506 12:65839894-65839916 CTGTCTCTAGGTCATCCTTCTGG + Intronic
1099535213 12:83834891-83834913 AAATTTCTGAGTCATCATTTTGG - Intergenic
1099874311 12:88385691-88385713 AAATCTTTGCGTTATCATTCTGG - Intergenic
1102824242 12:115934086-115934108 AGTTCTTTGGGTCAGCATTCTGG + Intergenic
1106071279 13:26413532-26413554 ATATCTCTGGCACATCTTGCTGG + Intergenic
1107827259 13:44339618-44339640 ATGTCTCAGGTTCATCGTTCAGG - Intergenic
1108076567 13:46686213-46686235 GTATCTTTGGGTCTTCACTCTGG - Intronic
1108203912 13:48069140-48069162 AAATTTCTGAGTCATCATTTTGG + Intronic
1109865500 13:68258526-68258548 AAATTTCTGAGTCATCATTTTGG + Intergenic
1110906323 13:80895328-80895350 GTATCTCTGGGTCTTCATTCTGG - Intergenic
1111007937 13:82274610-82274632 ATTTATTTGGCTCATCATTCTGG + Intergenic
1111744625 13:92251473-92251495 ATATCTCTGGATTATCCTTGGGG + Intronic
1114919581 14:27310190-27310212 AAATTTCTGAGTCATCATTTTGG + Intergenic
1115044804 14:28978459-28978481 ATCTCTCTTGGTCACCACTCAGG + Intergenic
1115543658 14:34445528-34445550 AAATTTCTGAGTCATCATTTTGG + Intronic
1115935287 14:38545169-38545191 ATTTCTATGGGTCAGAATTCTGG - Intergenic
1116103287 14:40468158-40468180 AAATTTCTGAGTCATCATTTTGG + Intergenic
1116576705 14:46584387-46584409 AAATTTCTGAGTCATCATTTTGG - Intergenic
1116632673 14:47355249-47355271 ATACCTTTGGGTCCTCATTCAGG - Intronic
1118759250 14:68869310-68869332 ATGTCTCTGGGACATCATAAAGG - Intergenic
1119014795 14:71039274-71039296 ATTTCTCTGGGTTATGAATCTGG + Intronic
1120227426 14:81807181-81807203 ATATCTGTATGTCAGCATTCTGG + Intergenic
1120756471 14:88249307-88249329 ATGTCCATGGGTTATCATTCAGG - Intronic
1120948877 14:90022796-90022818 AAATCTCTGGGTCATCCTCAAGG - Intronic
1121686280 14:95837664-95837686 ATAACTTTGGGTAATCATTTTGG + Intergenic
1122451889 14:101815637-101815659 TTATCTCTGAGTGATCACTCAGG + Intronic
1123118368 14:105904983-105905005 AAATCACAGAGTCATCATTCTGG + Intergenic
1125805841 15:42492890-42492912 TAAACTCTGGGCCATCATTCAGG + Intronic
1125851158 15:42904157-42904179 ATGTCTGTGGGTCAAGATTCTGG - Intronic
1127353944 15:58180313-58180335 CTATGTCTAGGTCATCATTTGGG - Intronic
1129260096 15:74361043-74361065 AAATTTCTGAGTCATCATTTTGG + Intronic
1129364653 15:75046903-75046925 ATCTCTCTGGGTCACCAGTCTGG + Intronic
1135638567 16:24100361-24100383 CTAGCTTTGGGGCATCATTCTGG + Intronic
1137008952 16:35304736-35304758 ATATCTCTGGCTCGGTATTCAGG - Intergenic
1137015604 16:35371303-35371325 ATATATCTGGCTCAGTATTCAGG - Intergenic
1137022974 16:35448938-35448960 ATATCTCTGGGTCATCATTCAGG - Intergenic
1137034882 16:35561504-35561526 ATATCTCTGGCCCATCACCCAGG - Intergenic
1137942294 16:52699995-52700017 CTATCCCTGGGTCATCTTCCAGG + Intergenic
1141750701 16:85956007-85956029 ACAGCTCTCGGTCTTCATTCAGG + Intergenic
1142894430 17:2964710-2964732 AAATCTCTCCGTCCTCATTCAGG + Intronic
1144228119 17:13171929-13171951 AAATTTCTGAGTCATCATTTTGG + Intergenic
1148700468 17:49583660-49583682 ATATAGCTGGGTCCTCATCCTGG + Intronic
1149102589 17:52923839-52923861 AAATATCTGAGTCATCATTTTGG - Intergenic
1149403831 17:56326779-56326801 ATATATCTGGGTTTGCATTCAGG - Intronic
1149854757 17:60071616-60071638 ATATCTCTGGGACATCTATTCGG - Intronic
1150988383 17:70226279-70226301 ATATCTCTGGGACATCTTTTTGG + Intergenic
1151050812 17:70977430-70977452 ATTTCTCTGGTTTATTATTCTGG - Intergenic
1158641059 18:59204103-59204125 AAATTTCTGAGTCATCATTTTGG + Intergenic
1159784184 18:72694297-72694319 AAATTTCTGAGTCATCATTTTGG + Intergenic
1160039199 18:75330297-75330319 CTGTCTCTGGGTCAACATCCTGG + Intergenic
1164041064 19:21493082-21493104 ATATCTCTGGGCCTACATCCAGG + Intergenic
930511913 2:52356872-52356894 ATATGTCTCTGTGATCATTCTGG - Intergenic
930559847 2:52948032-52948054 TTATCACTGGGTCATCTTTCTGG - Intergenic
931225537 2:60326214-60326236 GTTTCTTTGTGTCATCATTCAGG - Intergenic
932011975 2:67987815-67987837 ATATCTCTGAGTCCTCCTTTTGG - Intergenic
933131200 2:78676034-78676056 AAATTTCTGAGTCATCATTTTGG - Intergenic
933518426 2:83336275-83336297 ATTTCTCTGTATAATCATTCAGG + Intergenic
936476754 2:112846243-112846265 AGATCTCTTGCTCATCTTTCTGG + Intergenic
936858679 2:116990231-116990253 ATATTATTGGGTCATCAGTCAGG - Intergenic
939800865 2:146706155-146706177 AAATCTTTAGGACATCATTCTGG + Intergenic
939880948 2:147630671-147630693 ATATGTCTGGGTGATGCTTCTGG + Intergenic
941860096 2:170270376-170270398 AAATCTCTGGTTCTTGATTCAGG - Intronic
941877599 2:170450432-170450454 AAATTTCTGGGTTATCATTTTGG - Intronic
941889060 2:170559209-170559231 GTACCTCTGGATCAGCATTCTGG + Intronic
942758412 2:179369110-179369132 ATATTTCTAGGTCATGATGCTGG - Intergenic
942839117 2:180338180-180338202 AAATTTCTGAGTCATCATTTTGG + Intergenic
943214616 2:185014276-185014298 AAATTTCTGAGTCATCATTTTGG + Intergenic
943442680 2:187945239-187945261 ATATCTCTGAGGCATCAATATGG + Intergenic
945933993 2:215884613-215884635 ATATCTCAGAGTAAGCATTCTGG - Intergenic
1168984155 20:2033459-2033481 GTATCTCTGGGTCTTCTCTCCGG - Intergenic
1172188969 20:33050144-33050166 AAATTTCTGGGTCCACATTCTGG - Intergenic
1172945168 20:38681666-38681688 TTAGCTCTAGGTCATCATTAAGG - Intergenic
1178084720 21:29101122-29101144 ATTTCTGTGGGTCAGCAATCTGG + Intronic
1179956536 21:44742948-44742970 AAATGTCTGAGTCATCATTTTGG + Intergenic
1182215257 22:28711343-28711365 ATTTCTCTGGCTGATCATTTAGG - Intronic
1183228730 22:36567660-36567682 ACACCTCTGGGTCCTCATTCAGG - Intronic
950064599 3:10101824-10101846 AAATCTCTGAGTCATGATTCTGG + Intronic
951255996 3:20450156-20450178 GTATCTTTGAGTCATCATTTTGG - Intergenic
951345686 3:21544734-21544756 AAATTTCTGAGTCATCATTTTGG + Intronic
954529513 3:51306544-51306566 ATACCTGTGGGGCATCATTAAGG - Intronic
955567391 3:60262040-60262062 ATGTCTTTGGGTCTTCATTTTGG + Intronic
955722086 3:61893442-61893464 ATCACTCTGGGTAATCACTCTGG - Intronic
957952371 3:87142870-87142892 AAATTTCTGAGTCATCATTTTGG + Intergenic
958261318 3:91384439-91384461 ATAACTCAGGGTCATCATTATGG - Intergenic
959431299 3:106257955-106257977 AAATTTCTGAGTCATCATTTTGG + Intergenic
959588272 3:108046892-108046914 ATATCTCTGGGTAATCACCAGGG + Intronic
961499844 3:127324385-127324407 ATATTTCTGGGTGTTCATGCTGG + Intergenic
962630274 3:137268966-137268988 CTTTCTCTGGGTGATAATTCTGG + Intergenic
963585648 3:147184786-147184808 ATAATTCTGGGTTTTCATTCTGG - Intergenic
964533859 3:157698203-157698225 ATATCTATGGTTCATCCTACAGG + Intergenic
965027899 3:163326243-163326265 AAATATCTGAGTCATCATTTTGG + Intergenic
966496000 3:180581536-180581558 ATATGGCTGTGTCATCATGCAGG - Intergenic
967954937 3:194870774-194870796 ATAGCTCTGGGCTATGATTCTGG - Intergenic
971297029 4:25404270-25404292 AGCTCTCTGGTTCCTCATTCTGG - Intronic
971536105 4:27753715-27753737 ATCTGTCTGGGTCTACATTCAGG - Intergenic
974467572 4:62276751-62276773 CTTTCTCTGGGTTATCACTCCGG - Intergenic
974665456 4:64955293-64955315 AAATTTCTGAGTCATCATTTTGG + Intergenic
975141098 4:70919390-70919412 AAATTTCTGAGTCATCATTCTGG - Intronic
975614451 4:76232871-76232893 AAATTTCTGAGTCATCATTTTGG - Intronic
975756322 4:77575206-77575228 AAATTTCTGAGTCATCATTTTGG + Intronic
976345084 4:83991122-83991144 AAATTTCTGAGTCATCTTTCTGG + Intergenic
978080004 4:104580752-104580774 CTATCCCTGGTTCATCACTCAGG + Intergenic
979809752 4:125021901-125021923 GTATCTTTGGGGCTTCATTCTGG - Intergenic
979811557 4:125042493-125042515 ATGTCTCGGTGTCATCATTTTGG + Intergenic
980302139 4:131009183-131009205 AAATTTCTGAGTCATCATTTTGG - Intergenic
980984758 4:139684620-139684642 GTATCTGTAGGTCATCTTTCTGG + Intronic
981255634 4:142657758-142657780 AAATTTCTGAGTCATCATTTTGG + Intronic
981456199 4:144955850-144955872 AAATTTCTGAGTCATCATTTTGG + Intergenic
981770402 4:148301652-148301674 AAATTTCTGAGTCATCATTTTGG + Intronic
983321371 4:166200191-166200213 AAATTTCTGAGTCATCATTTTGG + Intergenic
984016090 4:174428740-174428762 ATCTCTCAGGATCATCATTTTGG + Intergenic
986213515 5:5696439-5696461 AAATTTCTGAGTCATCATTTTGG + Intergenic
986891777 5:12318015-12318037 ATATCTGTGTGTCATCGCTCTGG + Intergenic
987841971 5:23233810-23233832 AAATTTCTGAGTCATCATTTTGG - Intergenic
988316241 5:29633436-29633458 ATTCCTCTGGGTCAGGATTCTGG + Intergenic
988899919 5:35720973-35720995 AAATTTCTGAGTCATCATTTTGG - Intronic
989788281 5:45358467-45358489 ATTTCTCTGCATCACCATTCTGG + Intronic
995981164 5:118106045-118106067 ATGTCTGTGGGTCAGCAATCTGG + Intergenic
996234894 5:121114715-121114737 ATTTCTCTGTGTTATCATTTGGG + Intergenic
997080308 5:130731071-130731093 AAATCTCTGGGCCATGACTCTGG - Intergenic
1000577286 5:162989990-162990012 ACATTTCTGGGTAATCATTTTGG + Intergenic
1004136752 6:12974731-12974753 TTATCTCTGGGTCAGCCTTTTGG - Intronic
1005679035 6:28187322-28187344 ATATCTGTGGGTCAAGAGTCTGG + Intergenic
1007500373 6:42292440-42292462 ATGTCTCTGGATCATCATTGTGG - Intronic
1008501594 6:52189055-52189077 ATCTCTCAGGGTCCTCATTGCGG - Exonic
1008993841 6:57635715-57635737 ATAACTCAGGGTCATCATTATGG + Intronic
1009182451 6:60534799-60534821 ATAACTCAGGGTCATCATTATGG + Intergenic
1009631982 6:66211758-66211780 AAATTTCTGAGTCATCATTCTGG + Intergenic
1009861508 6:69340143-69340165 ATTTCTCTGGATCATGATTGAGG + Intronic
1010541455 6:77097040-77097062 AAATTTCTGAGTCATCATTTTGG + Intergenic
1010872691 6:81061886-81061908 AAATTTCTGAGTCATCATTTTGG - Intergenic
1011125473 6:84002809-84002831 ATATCCCTGATTCATAATTCTGG - Intergenic
1014287722 6:119520102-119520124 ACATCTCTTGGTCATCATTTTGG + Intergenic
1014908652 6:127062194-127062216 ATATCTCAGTGTCAACATTCTGG + Intergenic
1014921422 6:127218278-127218300 ATCTCTGTGGGTCAGCAGTCTGG + Intergenic
1015858845 6:137654484-137654506 AAATTTCTGAGTCATCATTTTGG + Intergenic
1016960807 6:149670940-149670962 TTTTCTATGGGTCATGATTCTGG + Intronic
1017204001 6:151785687-151785709 ATGACTCTGGGTCGTCACTCTGG + Intronic
1020936390 7:14470447-14470469 ATATCACAATGTCATCATTCAGG - Intronic
1021647982 7:22805108-22805130 ACATTTCTGAGTCATCATTTTGG + Intergenic
1024980642 7:55154984-55155006 ATATATCTGTGTCATCACTGTGG - Intronic
1031145080 7:117988754-117988776 ATTTCTCTGGGTGATTCTTCAGG - Intergenic
1031547669 7:123069402-123069424 ATATCTGTGGGACATCTCTCTGG - Intergenic
1036575910 8:10027546-10027568 GTACCTCTGGGTCTTCAGTCTGG - Intergenic
1040064670 8:43135786-43135808 AAATTTCTGAGTCATCATTTTGG + Intergenic
1040758189 8:50806202-50806224 AAATTTCTGAGTCATCATTTTGG + Intergenic
1041175482 8:55192710-55192732 TAATCTCGGGGTCATTATTCTGG + Intronic
1041565580 8:59274511-59274533 ATATCTCTGGGTCTTAAGTGAGG + Intergenic
1042425717 8:68645490-68645512 AAATCTCTGGTCCATCTTTCAGG + Intronic
1043111368 8:76187138-76187160 ATATCTGTGTTTCCTCATTCAGG - Intergenic
1047568461 8:126072582-126072604 GTATGTCTTGGTGATCATTCTGG - Intergenic
1048175837 8:132151632-132151654 AAATTTCTGAGTCATCATTTTGG + Intronic
1048319987 8:133391275-133391297 GTAGCTCTAGGTCATCACTCAGG - Intergenic
1050157484 9:2682934-2682956 ATATTTCTGGCCCATCACTCTGG + Intergenic
1050509844 9:6382908-6382930 AAATTTCTGAGTCATCATTTTGG - Intergenic
1050929479 9:11305494-11305516 AAATTTCTGAGTCATCATTTTGG + Intergenic
1051257208 9:15226744-15226766 ATATCTGTGGGTCAACAAACTGG - Intronic
1054862742 9:69970133-69970155 ACATCTCTTTCTCATCATTCTGG + Intergenic
1054931915 9:70643953-70643975 ATATGTCTCGGTCCTCATGCTGG - Intronic
1057673440 9:97116731-97116753 ACATCTCTGAGTGCTCATTCTGG - Intergenic
1058295060 9:103295778-103295800 GTATCTTTGGGTCTTCATTCTGG + Intergenic
1186317243 X:8384186-8384208 ATTTCTCTGGAACATCCTTCAGG + Intergenic
1187361332 X:18630303-18630325 ATGCCTCTGGGTCATCCTTGAGG + Intronic
1187435572 X:19265884-19265906 ATATGTCTGACACATCATTCAGG + Intergenic
1188457957 X:30388955-30388977 ATATTTCCTGGTCATCCTTCAGG - Intergenic
1189153136 X:38727860-38727882 AAATGTCTGAGTCATCATTTTGG + Intergenic
1189316507 X:40060781-40060803 ATATCTCTGGATTATCTTTGAGG - Intronic
1189573231 X:42322018-42322040 ATATCCCTGGGTGTTCATTCTGG + Intergenic
1191189644 X:57652886-57652908 AAATGTCTGAGTCATCATTTTGG + Intergenic
1191644899 X:63469686-63469708 AAATTTCTGAGTCATCATTTTGG - Intergenic
1193228853 X:79018912-79018934 AAATTTCTGAGTCATCATTTTGG + Intergenic
1193945320 X:87726887-87726909 AAACTTCTGGGTCATCATTTTGG - Intergenic
1194131420 X:90086704-90086726 AAATTTCTGAGTCATCATTTTGG - Intergenic
1194138328 X:90176095-90176117 AAATCTTTGAGTCATCATTTTGG - Intergenic
1195343613 X:103927224-103927246 ATATTTTTGGGTCATCATACTGG + Intronic
1196643639 X:118092706-118092728 ATATTTCTGTATCATCATTGTGG + Intronic
1197243202 X:124141909-124141931 AAATTTCTGAGTCATCATTTTGG - Intronic
1197843087 X:130771157-130771179 AAATCTCTGTGCCATCTTTCAGG + Intronic
1198107921 X:133478581-133478603 TCTTCTGTGGGTCATCATTCAGG + Intergenic
1198730324 X:139721167-139721189 ATAACGCTGAGTCATCATTATGG - Intergenic
1199043643 X:143143157-143143179 AAATTTCTGAGTCATCATTTTGG - Intergenic
1199084274 X:143610685-143610707 ATATATTTGGTTCATCATTCTGG - Intergenic
1199376634 X:147119794-147119816 ATGTCTATGGGTCAGCAATCTGG + Intergenic
1200139547 X:153892462-153892484 ATCTCTGTGGGTCAGGATTCAGG - Intronic
1200484126 Y:3746334-3746356 AAATCTTTGAGTCATCATTTTGG - Intergenic
1200794754 Y:7330747-7330769 GTATCTTTGGGTGTTCATTCTGG - Intergenic
1200862740 Y:8010218-8010240 ATATTTCTGGGCCAGCATTTAGG - Intergenic
1200889137 Y:8304359-8304381 ATATTTCTAAGTCATCATTTTGG - Intergenic
1200891739 Y:8331350-8331372 CTATTTCTGGCTCAGCATTCAGG + Intergenic
1202072222 Y:21004114-21004136 ATATCCCTGGCTCACCACTCAGG - Intergenic
1202247526 Y:22835043-22835065 ATATTTCTGTGCCATCATTTAGG + Intergenic
1202400514 Y:24468791-24468813 ATATTTCTGTGCCATCATTTAGG + Intergenic
1202470266 Y:25201295-25201317 ATATTTCTGTGCCATCATTTAGG - Intergenic