ID: 1137022975

View in Genome Browser
Species Human (GRCh38)
Location 16:35448950-35448972
Sequence ATGGATACTGACATATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137022975_1137022979 0 Left 1137022975 16:35448950-35448972 CCCAGAGATATGTCAGTATCCAT 0: 1
1: 0
2: 0
3: 11
4: 237
Right 1137022979 16:35448973-35448995 TTTGAGAGAAGAGCCCTGGCAGG No data
1137022975_1137022982 17 Left 1137022975 16:35448950-35448972 CCCAGAGATATGTCAGTATCCAT 0: 1
1: 0
2: 0
3: 11
4: 237
Right 1137022982 16:35448990-35449012 GGCAGGAAAGTCACATGACCTGG 0: 1
1: 3
2: 22
3: 259
4: 2216
1137022975_1137022978 -4 Left 1137022975 16:35448950-35448972 CCCAGAGATATGTCAGTATCCAT 0: 1
1: 0
2: 0
3: 11
4: 237
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137022975 Original CRISPR ATGGATACTGACATATCTCT GGG (reversed) Intergenic
900035128 1:401480-401502 ATGGTGCCTGACATATCTCAGGG - Intergenic
900056748 1:637233-637255 ATGGTGCCTGACATATCTCAGGG - Intergenic
902367623 1:15987589-15987611 GTGGATACTCACATGTCTCCTGG - Intergenic
905262221 1:36727929-36727951 ATAGATATTGAGATGTCTCTGGG + Intergenic
911885489 1:103292560-103292582 ATGGACACTAACATATGTCCTGG + Intergenic
916519198 1:165548404-165548426 ATGGAGACTTACGTAACTCTAGG + Intronic
919100027 1:193084198-193084220 ATATATAAGGACATATCTCTGGG - Intronic
919240159 1:194905038-194905060 ATGGAAATTAACATATCTTTTGG + Intergenic
920924011 1:210324960-210324982 TTGGATATTGATATTTCTCTAGG + Intergenic
921608660 1:217184860-217184882 AAAGATACTGAAATGTCTCTGGG - Intergenic
922257660 1:223907036-223907058 ATGGTGCCTGACATATCTCAGGG - Intergenic
924338854 1:243009815-243009837 ATGGTGCCTGACATATCTCAGGG - Intergenic
924575691 1:245278849-245278871 ATGGAGACTCACTGATCTCTTGG + Intronic
1064973859 10:21093377-21093399 AGGGAGACTGTCATCTCTCTTGG + Intronic
1065162985 10:22942745-22942767 GTGGATACATACATTTCTCTTGG - Intronic
1066625960 10:37405722-37405744 ATAAATACAGACAAATCTCTTGG - Intergenic
1073843681 10:107527762-107527784 ATGGACAGTGAACTATCTCTAGG + Intergenic
1074067834 10:110034319-110034341 ATTGATATTGACATATATCTTGG + Intronic
1075218767 10:120565212-120565234 AAAGATACTGGCATATCTGTGGG - Intronic
1081043842 11:38247215-38247237 AGGAATACAGATATATCTCTTGG - Intergenic
1081058466 11:38441350-38441372 ATGCATACTGAGATATCTTGGGG - Intergenic
1081219757 11:40446060-40446082 TTTGCTACTTACATATCTCTTGG + Intronic
1083039961 11:59676207-59676229 GTGGGAACTGACATATCTCCAGG + Intergenic
1086077043 11:82865807-82865829 ATGGAGACTGACAGCTTTCTGGG + Intronic
1088330817 11:108649133-108649155 CTGGATATTGATATTTCTCTAGG - Intergenic
1089246702 11:117126396-117126418 CTGGATACTGACAACTCTGTAGG - Intergenic
1089631267 11:119785919-119785941 ATGGATACCCACCTCTCTCTGGG - Intergenic
1089853622 11:121521323-121521345 ATGGATATAGACAAATATCTGGG + Intronic
1093430128 12:19075388-19075410 ATGGATTCACACATATGTCTTGG + Intergenic
1093518309 12:20017367-20017389 AGGGATACTGAAATATTTTTAGG - Intergenic
1094092565 12:26667340-26667362 AAGTATACTGAAATTTCTCTGGG - Intronic
1095744931 12:45647442-45647464 ATGGATACAGATATGGCTCTAGG - Intergenic
1097923999 12:65107710-65107732 ATTGATACTGAAATAGCCCTTGG + Intronic
1098966461 12:76794417-76794439 CTGGATACTGGTTTATCTCTAGG - Intronic
1101647764 12:106646876-106646898 GTGGACACTGACATTTCTCAGGG - Intronic
1104515493 12:129421416-129421438 ATGTATCCAGACATGTCTCTAGG - Intronic
1108358054 13:49644734-49644756 ATAGATACTGAAATATGTATGGG - Intergenic
1110579503 13:77104491-77104513 ATGGAGAATGACACATCTGTAGG - Intronic
1111286572 13:86101580-86101602 AAGGACATTGACATATCTTTAGG - Intergenic
1113101947 13:106730321-106730343 AAGGATTCTGACTTATTTCTGGG + Intergenic
1114768078 14:25397538-25397560 ATGGATACTTACCTATGCCTAGG + Intergenic
1115103702 14:29734420-29734442 ATGGATATTGACATTTGTCTTGG + Intronic
1115778842 14:36747070-36747092 ATGGATACTGAGTCATGTCTGGG - Intronic
1116389311 14:44374192-44374214 ATGGAAACTGAAATAGTTCTAGG + Intergenic
1116545363 14:46158928-46158950 ATGGATACTTTCAAATGTCTAGG - Intergenic
1117196451 14:53344530-53344552 TTGGATACTCACAAATCTGTTGG - Intergenic
1119518444 14:75266967-75266989 ATGTATGCTGACATATTTCTGGG - Intronic
1121917585 14:97850193-97850215 ATGCACATTGACATATTTCTGGG + Intergenic
1122282690 14:100633468-100633490 GTGGATGCTGACGTATCTCCTGG + Intergenic
1126935773 15:53705911-53705933 AAGGAAACTGACTTACCTCTAGG + Exonic
1128032454 15:64493168-64493190 ATGGATACAGAGATCTCTCGGGG + Intronic
1128591186 15:68898993-68899015 ATAGATACTGTAATATCTATGGG + Intronic
1128825113 15:70707953-70707975 ATGGATATGCAGATATCTCTAGG - Intronic
1128825902 15:70716770-70716792 ATGAATACTTGCATATCTTTGGG - Intronic
1128989205 15:72244736-72244758 ATACATACTCACATATCTATAGG + Intronic
1132680785 16:1140889-1140911 CTGGTTACTGACATCTCACTGGG + Intergenic
1133639417 16:7702400-7702422 AAGGCTTCTGACAAATCTCTTGG - Intronic
1134784109 16:16925356-16925378 ATGTATACGGACATAAATCTAGG - Intergenic
1137008013 16:35296557-35296579 AAGCATAATGACATATCACTGGG + Intergenic
1137008084 16:35297087-35297109 GTGTATTGTGACATATCTCTGGG + Intergenic
1137022975 16:35448950-35448972 ATGGATACTGACATATCTCTGGG - Intergenic
1137035920 16:35569811-35569833 AAGGATTTTGACATATCCCTGGG - Intergenic
1141555314 16:84833429-84833451 ATTGATAATGAAATATCACTAGG - Intronic
1144281345 17:13730168-13730190 TTGGACATTGACATATCTTTTGG - Intergenic
1146107407 17:30052507-30052529 TTGGATACTTACAAATCTGTGGG + Intronic
1147051930 17:37801570-37801592 AAGGACTCTGAGATATCTCTGGG - Intergenic
1148943407 17:51236109-51236131 ATAGATATTGACATATCTATAGG - Intronic
1203164517 17_GL000205v2_random:81426-81448 AGGCAAAGTGACATATCTCTGGG + Intergenic
1156375117 18:36507386-36507408 ATACATAATGACATATCTCAAGG - Intronic
1156488573 18:37482633-37482655 AGGGAAGCTGACATTTCTCTTGG - Intronic
1156751390 18:40460542-40460564 ATGGAAAATTATATATCTCTAGG - Intergenic
1158494812 18:57945435-57945457 CTGGATATTGTCATACCTCTGGG + Intergenic
1161079921 19:2305610-2305632 AGGGATGCTGACATCTCCCTTGG + Intronic
1164040370 19:21487801-21487823 GTGCATTGTGACATATCTCTGGG + Intronic
1164052338 19:21594045-21594067 TGGGATTGTGACATATCTCTTGG + Intergenic
1164052713 19:21596805-21596827 AAAGATTGTGACATATCTCTGGG + Intergenic
1164082906 19:21875966-21875988 AAGGATTGTGACATATCGCTGGG + Intergenic
1164084856 19:21891734-21891756 ACGCATTGTGACATATCTCTGGG + Intergenic
1164088252 19:21923795-21923817 AGGTATTTTGACATATCTCTGGG + Intergenic
1164099664 19:22043608-22043630 ATGTATTGTGACATATATCTGGG - Intergenic
1164109026 19:22137422-22137444 AGGTATTTTGACATATCTCTGGG + Intergenic
1164127207 19:22329371-22329393 ATAGATTGTGGCATATCTCTAGG + Intergenic
1164127828 19:22334607-22334629 AAAGATAGTGACATATCACTAGG - Intergenic
1164171680 19:22730792-22730814 AAAGATAGTGACATATCGCTAGG + Intergenic
1164180148 19:22811201-22811223 ATGGATGGTGACATATCACTGGG + Intergenic
1164181804 19:22825705-22825727 AGGGATGGTGACATATCACTGGG + Intergenic
1164190888 19:22916085-22916107 AAGGATTGTGACATATCGCTGGG + Intergenic
1164191315 19:22919823-22919845 AGGTATTTTGACATATCTCTGGG + Intergenic
1164191772 19:22924529-22924551 GGGGATTGTGACATATCTCTGGG + Intergenic
1164204283 19:23044933-23044955 AGAGATTGTGACATATCTCTGGG - Intergenic
1164207154 19:23068600-23068622 GTGCATTGTGACATATCTCTGGG - Intergenic
1164233873 19:23315301-23315323 AGGCATTATGACATATCTCTGGG + Intronic
1164233880 19:23315377-23315399 AGAGATAGTGACGTATCTCTGGG + Intronic
1164234604 19:23321496-23321518 AGGGATGGTGACATATCCCTGGG + Intronic
1164242567 19:23402757-23402779 ATGCATTGTCACATATCTCTGGG - Intergenic
1164243137 19:23407834-23407856 AGGGATTGTGACATATCACTGGG - Intergenic
1164248730 19:23458254-23458276 AGAGATTGTGACATATCTCTGGG + Intergenic
1164255058 19:23520771-23520793 GTGCATTGTGACATATCTCTGGG - Intergenic
1164260081 19:23561719-23561741 AGGGATTGTGACATATCACTTGG - Intronic
1164260556 19:23565406-23565428 AGGGATTGTGACATATCACTGGG - Intronic
1164302621 19:23975052-23975074 AGGGATGGTGACATATCCCTGGG - Intergenic
1164303297 19:23980937-23980959 AGAAATAGTGACATATCTCTGGG - Intergenic
1164303922 19:23986871-23986893 AAAGATTGTGACATATCTCTTGG - Intergenic
1164314428 19:24074468-24074490 AGAGATTGTGACATATCTCTGGG + Intronic
1164324947 19:24182905-24182927 AGGCATAGTGACATATCGCTGGG - Intergenic
1164325099 19:24184387-24184409 AGGGATTGTGACATATATCTTGG - Intergenic
1164325607 19:24188671-24188693 AGAGATAGTGACATATTTCTGGG - Intergenic
1165854828 19:38873422-38873444 ATTGATACTGAAAAATATCTTGG + Intronic
1167759738 19:51438439-51438461 AGGGATCCTGGCAAATCTCTGGG - Intergenic
925530597 2:4856660-4856682 ATGTGTATTGTCATATCTCTTGG + Intergenic
939380822 2:141434241-141434263 ATGGTGTCTGACATTTCTCTGGG + Intronic
940923547 2:159337854-159337876 TTGGATACTGGCAGATCTCAAGG + Intronic
943295986 2:186139780-186139802 ATGGATACTTCCATATTTGTGGG - Intergenic
944552114 2:200853993-200854015 ATGGATATTGACTTATTTTTAGG - Exonic
944863715 2:203840201-203840223 AGGGATTAGGACATATCTCTGGG + Intergenic
945502700 2:210596599-210596621 ATGCATACTCACATATTTTTTGG + Intronic
949001546 2:241617107-241617129 ATGGATCTTAACATATATCTAGG - Intronic
1168899820 20:1353884-1353906 TTGAATATTGATATATCTCTAGG + Intronic
1169813758 20:9634877-9634899 TTGGACACTCACATTTCTCTTGG - Intronic
1170043197 20:12059861-12059883 ATGGAGACTGAGATAGCTCAAGG - Intergenic
1170186104 20:13593067-13593089 ATGGATACTGAATTATTTTTAGG - Intronic
1172303658 20:33866498-33866520 TTGGATGTTGACATATCTTTGGG + Intergenic
1173186151 20:40841987-40842009 ATGCATACTGACATATTTAGAGG + Intergenic
1174026549 20:47581228-47581250 ATGCATACTGAGATATCTAGGGG - Intronic
1175104480 20:56604757-56604779 ATGGACACTGATATATTTCTGGG - Intergenic
1176338118 21:5617984-5618006 AAAGATTCTGACATATCACTGGG + Intergenic
1176339526 21:5681057-5681079 AAAGATTCTGACATATCACTGGG + Intergenic
1176471780 21:7113210-7113232 AAAGATTCTGACATATCACTGGG + Intergenic
1176495341 21:7494988-7495010 AAAGATTCTGACATATCACTGGG + Intergenic
1176505301 21:7643399-7643421 AAAGATTCTGACATATCACTGGG - Intergenic
1180018371 21:45102691-45102713 ATGGATATTTATTTATCTCTGGG - Intronic
1180632664 22:17240560-17240582 ATGGATAATGCCATCTTTCTAGG + Intergenic
1181362545 22:22349262-22349284 ATGGTTTCTGACAGAGCTCTGGG - Intergenic
1182202022 22:28582894-28582916 ATGGCTACTGACATATCACCTGG - Intronic
951774275 3:26291580-26291602 ATAGATACTAAAATATCTATTGG - Intergenic
952356729 3:32591745-32591767 ATAGACACTGACATAGTTCTTGG + Intergenic
952585040 3:34882119-34882141 ATGTTTAATGAAATATCTCTTGG - Intergenic
955496722 3:59541277-59541299 ATTGATACTGACTCATCGCTTGG + Intergenic
957390096 3:79553803-79553825 CTGGATCCAGACAGATCTCTTGG - Intronic
960016788 3:112899928-112899950 ATGGATATTGAAAAATCTGTTGG + Intergenic
960704870 3:120472304-120472326 ATGGATATAGATATCTCTCTGGG - Intergenic
961237870 3:125383936-125383958 ATGGATAGTGACATTCCTGTGGG - Intergenic
966149668 3:176853279-176853301 ATGAATACTGACATATGTAGGGG + Intergenic
971011430 4:22440807-22440829 ATGAATTCTGACATATGTATAGG + Intronic
971504463 4:27351114-27351136 ATGGATAATGAGAAAACTCTTGG - Intergenic
972801148 4:42476879-42476901 AGGGATACTGAAATTTCTGTTGG - Intronic
973979587 4:56296808-56296830 TTGGAAACTAACTTATCTCTGGG - Intronic
975018729 4:69460026-69460048 ATGTATAGTTACATATTTCTGGG + Intergenic
978180810 4:105793440-105793462 ATACATACTGACATATTTCAAGG + Intronic
979238266 4:118425423-118425445 ATGGTGCCTGACATATCTCAGGG + Intergenic
981095793 4:140779140-140779162 ATGAATACTCAAATATTTCTTGG - Intergenic
983995080 4:174172693-174172715 AAGGATACTGACATCTCTTAAGG + Intergenic
984096792 4:175444771-175444793 ATAGACTCTGACATATCTCCCGG + Intergenic
984682609 4:182627191-182627213 TTGGATACTTACATAACACTTGG + Intronic
986948619 5:13054437-13054459 GTGGATACTGACACAACTATGGG - Intergenic
986982763 5:13468431-13468453 ATTGAGACTGACATATGTATTGG + Intergenic
988900971 5:35731881-35731903 ATGGATAATGTAATATCTGTAGG - Intronic
993268651 5:85763162-85763184 TTGGATAGTGAGATAACTCTAGG - Intergenic
994810644 5:104514368-104514390 ATGAATACTGACTTTTCACTGGG + Intergenic
995834665 5:116387993-116388015 ATTGATATGGAAATATCTCTAGG + Intronic
996805967 5:127454290-127454312 AAGTATACTGATTTATCTCTGGG + Intronic
996923992 5:128800826-128800848 ATGTATACTTACAGATCTTTAGG + Intronic
999454704 5:151705542-151705564 ATAGATACTGAAATATTTATGGG + Intergenic
999852971 5:155562838-155562860 AAGCAGACTGGCATATCTCTAGG - Intergenic
1002738691 5:181417391-181417413 ATGGTGCCTGACATATCTCAGGG + Intergenic
1003818388 6:9867377-9867399 ATGGATACTGAAATATTTCATGG - Intronic
1012301456 6:97593299-97593321 ATGGATGTTGACATATCACATGG - Intergenic
1012537411 6:100315403-100315425 ATTGATACTATAATATCTCTTGG - Intergenic
1016765460 6:147788220-147788242 ATGTATACTGAAATATCCATAGG - Intergenic
1017885201 6:158593497-158593519 ATGGATACTGGCATATGCCCAGG - Intronic
1019243795 6:170692943-170692965 ATGGTGCCTGACATATCTCAGGG + Intergenic
1020346157 7:7165963-7165985 ATACATAATGAAATATCTCTGGG - Intronic
1021203118 7:17748106-17748128 ATGGAAACTGAAAATTCTCTGGG - Intergenic
1023574415 7:41610628-41610650 ATAAATACTTACATAACTCTGGG - Intergenic
1025751359 7:64296450-64296472 AGGGATTGTGACATATCACTGGG - Intergenic
1025758801 7:64371133-64371155 CTGGATAGTGACATATTGCTAGG + Intergenic
1025759574 7:64377515-64377537 CTGGAGAGTGACATATTTCTAGG + Intergenic
1025761555 7:64400726-64400748 GGGGATACTGACATATTGCTAGG + Intergenic
1025784498 7:64632306-64632328 AAGCATTGTGACATATCTCTGGG + Intergenic
1025785468 7:64639710-64639732 AAAGATTGTGACATATCTCTGGG + Intergenic
1025787802 7:64659379-64659401 CTGGATTATGACATATATCTTGG + Intergenic
1026290928 7:69005374-69005396 ATGGATTTTGAGATGTCTCTGGG - Intergenic
1027493936 7:78863936-78863958 ATGCATACTGACACATTTCAGGG - Intronic
1027611921 7:80372050-80372072 AGGGATAATGATATATTTCTTGG + Intronic
1028416224 7:90583286-90583308 ATGGATACAGAGGTGTCTCTAGG - Intronic
1032520225 7:132538206-132538228 GTGGACACTGACATGTCTCTGGG - Intronic
1033674889 7:143531159-143531181 ATGGATTCTGGCATGTCTGTTGG - Intergenic
1033696947 7:143798281-143798303 ATGGATTCTGGCATGTCTGTTGG + Intergenic
1035504328 8:115217-115239 ATGGTGCCTGACATATCTCAGGG - Intergenic
1040371428 8:46779738-46779760 AGGCATTGTGACATATCTCTGGG + Intergenic
1040379118 8:46855162-46855184 AGGCATTGTGACATATCTCTAGG + Intergenic
1040379893 8:46862371-46862393 CTGGACAGTGACATATTTCTAGG + Intergenic
1040381996 8:46882092-46882114 ATGCATTGTTACATATCTCTGGG - Intergenic
1040382705 8:46888266-46888288 AGGCATTGTGACATATCTCTGGG - Intergenic
1043499266 8:80836962-80836984 TTGGATACTGATGTATCTCCAGG + Intronic
1045538448 8:103057933-103057955 GTTGATACTGACAGATCTTTAGG + Intronic
1051921369 9:22269822-22269844 AAGGAGCCTGAAATATCTCTAGG - Intergenic
1053005651 9:34602616-34602638 ATGGAAACTGACAAAGCCCTTGG + Intergenic
1055573876 9:77643829-77643851 ATGGAAAATGACACCTCTCTAGG + Intronic
1058762234 9:108146345-108146367 ATGGAAAGTAACATATTTCTGGG - Intergenic
1060062460 9:120473262-120473284 ATGGAGAATGATAGATCTCTTGG - Intronic
1203423546 Un_GL000195v1:16934-16956 AAAGATTCTGACATATCACTGGG - Intergenic
1203603984 Un_KI270748v1:42166-42188 ATGGTGCCTGACATATCTCAGGG + Intergenic
1185629012 X:1502608-1502630 CAGGACACGGACATATCTCTGGG - Intronic
1186967831 X:14807315-14807337 ATGGAGGCTAACATTTCTCTTGG + Intergenic
1192110965 X:68363761-68363783 ATGCATACTGAAATATATATGGG + Intronic
1198847404 X:140927050-140927072 TTGGATGCGGACATATCTTTTGG + Intergenic
1199429882 X:147746651-147746673 ATAGATACTGGCATATAACTGGG + Intergenic
1200843134 Y:7804040-7804062 CTGGATAGTGACATATTGCTAGG - Intergenic
1200843803 Y:7811012-7811034 AGGCATTGTGACATATCTCTGGG - Intergenic
1200848657 Y:7859415-7859437 ATGCATTGTGACATATCTCTGGG - Intergenic
1200862640 Y:8009281-8009303 TTTGTGACTGACATATCTCTGGG - Intergenic
1200863429 Y:8017168-8017190 AGGCATTGTGACATATCTCTGGG - Intergenic
1200865660 Y:8040660-8040682 CTGGAGAGTGACATATTTCTAGG + Intergenic
1200868024 Y:8066348-8066370 CTGGAGAGTGACATATTTCTAGG + Intergenic
1200868840 Y:8075362-8075384 AAGGATAGTGACATATTTCAAGG - Intergenic
1200891823 Y:8332185-8332207 CTGGATAGTGACATATCACTAGG + Intergenic
1200901577 Y:8437815-8437837 CTGGAGAGTGACATATTTCTAGG - Intergenic
1202071614 Y:20997515-20997537 AGAGATTGTGACATATCTCTGGG - Intergenic
1202245211 Y:22812998-22813020 ATGCATTGTGACAAATCTCTGGG + Intergenic
1202246491 Y:22825623-22825645 CTGGATAGTGACATATTGCTAGG + Intergenic
1202248353 Y:22842703-22842725 ATGGATAATGACATATTGCAAGG + Intergenic
1202252545 Y:22888305-22888327 CTGGAGAGTGACATATTTCTAGG - Intergenic
1202255048 Y:22912328-22912350 AGGCATTGTGACATATCTCTGGG + Intergenic
1202261874 Y:22978732-22978754 CTGGAGACTGATATATTTCTAGG + Intronic
1202264432 Y:23003129-23003151 CTGGAGAATGACATATTTCTAGG + Intronic
1202265403 Y:23012757-23012779 CTGGAGAGTGACATATTTCTAGG + Intergenic
1202270723 Y:23071581-23071603 AGGCATTGTGACATATCTCTGGG + Intergenic
1202295303 Y:23349101-23349123 AGGCATTGTGACATATCTCTGGG - Intergenic
1202386041 Y:24327215-24327237 ATGGTGCCTGACATATCTCAGGG + Intergenic
1202398201 Y:24446744-24446766 ATGCATTGTGACAAATCTCTGGG + Intergenic
1202399479 Y:24459371-24459393 CTGGATAGTGACATATTGCTAGG + Intergenic
1202401341 Y:24476451-24476473 ATGGATAATGACATATTGCAAGG + Intergenic
1202405534 Y:24522054-24522076 CTGGAGAGTGACATATTTCTAGG - Intergenic
1202408039 Y:24546077-24546099 AGGCATTGTGACATATCTCTGGG + Intergenic
1202414862 Y:24612473-24612495 CTGGAGACTGATATATTTCTAGG + Intronic
1202417423 Y:24636871-24636893 CTGGAGAATGACATATTTCTAGG + Intronic
1202418396 Y:24646499-24646521 CTGGAGAGTGACATATTTCTAGG + Intergenic
1202423718 Y:24705325-24705347 AGGCATTGTGACATATCTCTGGG + Intergenic
1202447071 Y:24964760-24964782 AGGCATTGTGACATATCTCTGGG - Intergenic
1202452390 Y:25023587-25023609 CTGGAGAGTGACATATTTCTAGG - Intergenic
1202453363 Y:25033215-25033237 CTGGAGAATGACATATTTCTAGG - Intronic
1202455923 Y:25057613-25057635 CTGGAGACTGATATATTTCTAGG - Intronic
1202462743 Y:25124004-25124026 AGGCATTGTGACATATCTCTGGG - Intergenic
1202465246 Y:25148028-25148050 CTGGAGAGTGACATATTTCTAGG + Intergenic
1202469439 Y:25193635-25193657 ATGGATAATGACATATTGCAAGG - Intergenic
1202471301 Y:25210715-25210737 CTGGATAGTGACATATTGCTAGG - Intergenic
1202472580 Y:25223342-25223364 ATGCATTGTGACAAATCTCTGGG - Intergenic
1202484745 Y:25342913-25342935 ATGGTGCCTGACATATCTCAGGG - Intergenic