ID: 1137022976

View in Genome Browser
Species Human (GRCh38)
Location 16:35448951-35448973
Sequence AATGGATACTGACATATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137022976_1137022982 16 Left 1137022976 16:35448951-35448973 CCAGAGATATGTCAGTATCCATT No data
Right 1137022982 16:35448990-35449012 GGCAGGAAAGTCACATGACCTGG 0: 1
1: 3
2: 22
3: 259
4: 2216
1137022976_1137022978 -5 Left 1137022976 16:35448951-35448973 CCAGAGATATGTCAGTATCCATT No data
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data
1137022976_1137022979 -1 Left 1137022976 16:35448951-35448973 CCAGAGATATGTCAGTATCCATT No data
Right 1137022979 16:35448973-35448995 TTTGAGAGAAGAGCCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137022976 Original CRISPR AATGGATACTGACATATCTC TGG (reversed) Intergenic
No off target data available for this crispr