ID: 1137022978

View in Genome Browser
Species Human (GRCh38)
Location 16:35448969-35448991
Sequence CCATTTTGAGAGAAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137022974_1137022978 8 Left 1137022974 16:35448938-35448960 CCTGAATGATGACCCAGAGATAT 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data
1137022976_1137022978 -5 Left 1137022976 16:35448951-35448973 CCAGAGATATGTCAGTATCCATT No data
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data
1137022975_1137022978 -4 Left 1137022975 16:35448950-35448972 CCCAGAGATATGTCAGTATCCAT 0: 1
1: 0
2: 0
3: 11
4: 237
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data
1137022973_1137022978 16 Left 1137022973 16:35448930-35448952 CCACATCACCTGAATGATGACCC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data
1137022972_1137022978 29 Left 1137022972 16:35448917-35448939 CCAGGAAGGAGAACCACATCACC No data
Right 1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137022978 Original CRISPR CCATTTTGAGAGAAGAGCCC TGG Intergenic
No off target data available for this crispr