ID: 1137023289

View in Genome Browser
Species Human (GRCh38)
Location 16:35451313-35451335
Sequence AGTTTGGGTCTCCTAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023289_1137023296 20 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023296 16:35451356-35451378 AGAAGTGAATCCAAAGTGGCTGG No data
1137023289_1137023295 16 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023295 16:35451352-35451374 GAGGAGAAGTGAATCCAAAGTGG No data
1137023289_1137023297 23 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023297 16:35451359-35451381 AGTGAATCCAAAGTGGCTGGTGG No data
1137023289_1137023298 26 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023289_1137023292 -3 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023292 16:35451333-35451355 ACTCCAGCACGCACAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023289 Original CRISPR AGTTTGGGTCTCCTAGTCTC TGG (reversed) Intergenic
No off target data available for this crispr