ID: 1137023291

View in Genome Browser
Species Human (GRCh38)
Location 16:35451329-35451351
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023291_1137023298 10 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023291_1137023296 4 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023296 16:35451356-35451378 AGAAGTGAATCCAAAGTGGCTGG No data
1137023291_1137023297 7 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023297 16:35451359-35451381 AGTGAATCCAAAGTGGCTGGTGG No data
1137023291_1137023295 0 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023295 16:35451352-35451374 GAGGAGAAGTGAATCCAAAGTGG No data
1137023291_1137023300 15 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023300 16:35451367-35451389 CAAAGTGGCTGGTGGCGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023291 Original CRISPR TGGCTGTGCGTGCTGGAGTT TGG (reversed) Intergenic