ID: 1137023293

View in Genome Browser
Species Human (GRCh38)
Location 16:35451336-35451358
Sequence TCTCCTCTGGCTGTGCGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023293_1137023301 24 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023301 16:35451383-35451405 GGTGAGGCTTGAGCTCTCACAGG No data
1137023293_1137023300 8 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023300 16:35451367-35451389 CAAAGTGGCTGGTGGCGGTGAGG No data
1137023293_1137023297 0 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023297 16:35451359-35451381 AGTGAATCCAAAGTGGCTGGTGG No data
1137023293_1137023298 3 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023293_1137023296 -3 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023296 16:35451356-35451378 AGAAGTGAATCCAAAGTGGCTGG No data
1137023293_1137023295 -7 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023295 16:35451352-35451374 GAGGAGAAGTGAATCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023293 Original CRISPR TCTCCTCTGGCTGTGCGTGC TGG (reversed) Intergenic
No off target data available for this crispr