ID: 1137023294

View in Genome Browser
Species Human (GRCh38)
Location 16:35451349-35451371
Sequence CTTTGGATTCACTTCTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023294_1137023300 -5 Left 1137023294 16:35451349-35451371 CCAGAGGAGAAGTGAATCCAAAG No data
Right 1137023300 16:35451367-35451389 CAAAGTGGCTGGTGGCGGTGAGG No data
1137023294_1137023301 11 Left 1137023294 16:35451349-35451371 CCAGAGGAGAAGTGAATCCAAAG No data
Right 1137023301 16:35451383-35451405 GGTGAGGCTTGAGCTCTCACAGG No data
1137023294_1137023298 -10 Left 1137023294 16:35451349-35451371 CCAGAGGAGAAGTGAATCCAAAG No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023294 Original CRISPR CTTTGGATTCACTTCTCCTC TGG (reversed) Intergenic
No off target data available for this crispr