ID: 1137023296 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:35451356-35451378 |
| Sequence | AGAAGTGAATCCAAAGTGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137023289_1137023296 | 20 | Left | 1137023289 | 16:35451313-35451335 | CCAGAGACTAGGAGACCCAAACT | No data | ||
| Right | 1137023296 | 16:35451356-35451378 | AGAAGTGAATCCAAAGTGGCTGG | No data | ||||
| 1137023293_1137023296 | -3 | Left | 1137023293 | 16:35451336-35451358 | CCAGCACGCACAGCCAGAGGAGA | No data | ||
| Right | 1137023296 | 16:35451356-35451378 | AGAAGTGAATCCAAAGTGGCTGG | No data | ||||
| 1137023291_1137023296 | 4 | Left | 1137023291 | 16:35451329-35451351 | CCAAACTCCAGCACGCACAGCCA | No data | ||
| Right | 1137023296 | 16:35451356-35451378 | AGAAGTGAATCCAAAGTGGCTGG | No data | ||||
| 1137023290_1137023296 | 5 | Left | 1137023290 | 16:35451328-35451350 | CCCAAACTCCAGCACGCACAGCC | No data | ||
| Right | 1137023296 | 16:35451356-35451378 | AGAAGTGAATCCAAAGTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137023296 | Original CRISPR | AGAAGTGAATCCAAAGTGGC TGG | Intergenic | ||