ID: 1137023298

View in Genome Browser
Species Human (GRCh38)
Location 16:35451362-35451384
Sequence GAATCCAAAGTGGCTGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023294_1137023298 -10 Left 1137023294 16:35451349-35451371 CCAGAGGAGAAGTGAATCCAAAG No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023290_1137023298 11 Left 1137023290 16:35451328-35451350 CCCAAACTCCAGCACGCACAGCC No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023293_1137023298 3 Left 1137023293 16:35451336-35451358 CCAGCACGCACAGCCAGAGGAGA No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023289_1137023298 26 Left 1137023289 16:35451313-35451335 CCAGAGACTAGGAGACCCAAACT No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data
1137023291_1137023298 10 Left 1137023291 16:35451329-35451351 CCAAACTCCAGCACGCACAGCCA No data
Right 1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023298 Original CRISPR GAATCCAAAGTGGCTGGTGG CGG Intergenic
No off target data available for this crispr