ID: 1137023809

View in Genome Browser
Species Human (GRCh38)
Location 16:35454454-35454476
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137023801_1137023809 18 Left 1137023801 16:35454413-35454435 CCTGAGATCAGGCCGCAAAAATC No data
Right 1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG No data
1137023803_1137023809 6 Left 1137023803 16:35454425-35454447 CCGCAAAAATCTTGGCACAGCCA No data
Right 1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137023809 Original CRISPR GAGTGAGCCAGAAGAGGGGA AGG Intergenic
No off target data available for this crispr