ID: 1137025057

View in Genome Browser
Species Human (GRCh38)
Location 16:35465742-35465764
Sequence CAGTGTAAGTAGTAGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137025057_1137025059 -2 Left 1137025057 16:35465742-35465764 CCCTGACACTACTACTTACACTG No data
Right 1137025059 16:35465763-35465785 TGATTTGAAAGTCAGTGTTGAGG No data
1137025057_1137025060 2 Left 1137025057 16:35465742-35465764 CCCTGACACTACTACTTACACTG No data
Right 1137025060 16:35465767-35465789 TTGAAAGTCAGTGTTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137025057 Original CRISPR CAGTGTAAGTAGTAGTGTCA GGG (reversed) Intergenic
No off target data available for this crispr