ID: 1137028264

View in Genome Browser
Species Human (GRCh38)
Location 16:35499501-35499523
Sequence TCTGGGGTCCTGAAGCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137028258_1137028264 28 Left 1137028258 16:35499450-35499472 CCTTGTCACAATAGGGCACCTGA No data
Right 1137028264 16:35499501-35499523 TCTGGGGTCCTGAAGCGTCCAGG No data
1137028259_1137028264 10 Left 1137028259 16:35499468-35499490 CCTGACGCCATAGAGACTCGAGA No data
Right 1137028264 16:35499501-35499523 TCTGGGGTCCTGAAGCGTCCAGG No data
1137028260_1137028264 3 Left 1137028260 16:35499475-35499497 CCATAGAGACTCGAGAAATGTAC No data
Right 1137028264 16:35499501-35499523 TCTGGGGTCCTGAAGCGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137028264 Original CRISPR TCTGGGGTCCTGAAGCGTCC AGG Intergenic
No off target data available for this crispr