ID: 1137028584

View in Genome Browser
Species Human (GRCh38)
Location 16:35501573-35501595
Sequence CTGCTCCTGCAGCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137028584_1137028593 30 Left 1137028584 16:35501573-35501595 CCCTGTGCAGGCTGCAGGAGCAG No data
Right 1137028593 16:35501626-35501648 CCTTGTTTGTCCTTTTTTCCTGG No data
1137028584_1137028589 2 Left 1137028584 16:35501573-35501595 CCCTGTGCAGGCTGCAGGAGCAG No data
Right 1137028589 16:35501598-35501620 CACAACAAGGCCTGAACATGGGG No data
1137028584_1137028588 1 Left 1137028584 16:35501573-35501595 CCCTGTGCAGGCTGCAGGAGCAG No data
Right 1137028588 16:35501597-35501619 TCACAACAAGGCCTGAACATGGG No data
1137028584_1137028587 0 Left 1137028584 16:35501573-35501595 CCCTGTGCAGGCTGCAGGAGCAG No data
Right 1137028587 16:35501596-35501618 CTCACAACAAGGCCTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137028584 Original CRISPR CTGCTCCTGCAGCCTGCACA GGG (reversed) Intergenic
No off target data available for this crispr