ID: 1137029126

View in Genome Browser
Species Human (GRCh38)
Location 16:35506187-35506209
Sequence GCAGCCCGTCCCTAGCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137029126_1137029133 10 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029133 16:35506220-35506242 TCTGAAAGGGCGTGACAAGAGGG No data
1137029126_1137029136 24 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029136 16:35506234-35506256 ACAAGAGGGAGGAGCAAGAAGGG No data
1137029126_1137029130 -4 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029130 16:35506206-35506228 CTGCACTACGCATGTCTGAAAGG No data
1137029126_1137029135 23 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029135 16:35506233-35506255 GACAAGAGGGAGGAGCAAGAAGG No data
1137029126_1137029139 29 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG No data
1137029126_1137029140 30 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029140 16:35506240-35506262 GGGAGGAGCAAGAAGGGGCGGGG No data
1137029126_1137029137 25 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029137 16:35506235-35506257 CAAGAGGGAGGAGCAAGAAGGGG No data
1137029126_1137029132 9 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029132 16:35506219-35506241 GTCTGAAAGGGCGTGACAAGAGG No data
1137029126_1137029134 13 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029134 16:35506223-35506245 GAAAGGGCGTGACAAGAGGGAGG No data
1137029126_1137029138 28 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029138 16:35506238-35506260 GAGGGAGGAGCAAGAAGGGGCGG No data
1137029126_1137029131 -3 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029131 16:35506207-35506229 TGCACTACGCATGTCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137029126 Original CRISPR GCAGCCCGTCCCTAGCGGTG GGG (reversed) Intergenic
No off target data available for this crispr