ID: 1137029139

View in Genome Browser
Species Human (GRCh38)
Location 16:35506239-35506261
Sequence AGGGAGGAGCAAGAAGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137029127_1137029139 28 Left 1137029127 16:35506188-35506210 CCCACCGCTAGGGACGGGCTGCA No data
Right 1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG No data
1137029129_1137029139 24 Left 1137029129 16:35506192-35506214 CCGCTAGGGACGGGCTGCACTAC No data
Right 1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG No data
1137029126_1137029139 29 Left 1137029126 16:35506187-35506209 CCCCACCGCTAGGGACGGGCTGC No data
Right 1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG No data
1137029128_1137029139 27 Left 1137029128 16:35506189-35506211 CCACCGCTAGGGACGGGCTGCAC No data
Right 1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137029139 Original CRISPR AGGGAGGAGCAAGAAGGGGC GGG Intergenic
No off target data available for this crispr