ID: 1137032711

View in Genome Browser
Species Human (GRCh38)
Location 16:35538992-35539014
Sequence GACAGGGAAATGGCTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137032707_1137032711 24 Left 1137032707 16:35538945-35538967 CCTAAGAGTTTCGGTTAAATTCT No data
Right 1137032711 16:35538992-35539014 GACAGGGAAATGGCTAAAATAGG No data
1137032706_1137032711 25 Left 1137032706 16:35538944-35538966 CCCTAAGAGTTTCGGTTAAATTC No data
Right 1137032711 16:35538992-35539014 GACAGGGAAATGGCTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137032711 Original CRISPR GACAGGGAAATGGCTAAAAT AGG Intergenic
No off target data available for this crispr