ID: 1137034674

View in Genome Browser
Species Human (GRCh38)
Location 16:35559696-35559718
Sequence TTAAAATTCCCCAGGTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137034670_1137034674 -10 Left 1137034670 16:35559683-35559705 CCCCAGTAATACATTAAAATTCC No data
Right 1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG No data
1137034669_1137034674 1 Left 1137034669 16:35559672-35559694 CCAGGTGCTGTCCCCAGTAATAC No data
Right 1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137034674 Original CRISPR TTAAAATTCCCCAGGTAAGC AGG Intergenic
No off target data available for this crispr