ID: 1137036193

View in Genome Browser
Species Human (GRCh38)
Location 16:35572044-35572066
Sequence TGTGACTATTCTCTTTTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137036193_1137036198 23 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036198 16:35572090-35572112 ATATGTTACAATGCCCTCTGTGG No data
1137036193_1137036196 -7 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036196 16:35572060-35572082 AGTCACATCACCTAAATGGTGGG No data
1137036193_1137036200 28 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036200 16:35572095-35572117 TTACAATGCCCTCTGTGGGAAGG No data
1137036193_1137036195 -8 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036195 16:35572059-35572081 TAGTCACATCACCTAAATGGTGG No data
1137036193_1137036201 29 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG No data
1137036193_1137036199 24 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036199 16:35572091-35572113 TATGTTACAATGCCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137036193 Original CRISPR TGTGACTATTCTCTTTTGTC CGG (reversed) Intergenic
No off target data available for this crispr