ID: 1137036197

View in Genome Browser
Species Human (GRCh38)
Location 16:35572070-35572092
Sequence TATCTCTGTGCCCACCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137036197_1137036205 14 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036205 16:35572107-35572129 CTGTGGGAAGGGCTTTAGTAGGG No data
1137036197_1137036198 -3 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036198 16:35572090-35572112 ATATGTTACAATGCCCTCTGTGG No data
1137036197_1137036204 13 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036204 16:35572106-35572128 TCTGTGGGAAGGGCTTTAGTAGG No data
1137036197_1137036199 -2 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036199 16:35572091-35572113 TATGTTACAATGCCCTCTGTGGG No data
1137036197_1137036200 2 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036200 16:35572095-35572117 TTACAATGCCCTCTGTGGGAAGG No data
1137036197_1137036206 15 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036206 16:35572108-35572130 TGTGGGAAGGGCTTTAGTAGGGG No data
1137036197_1137036201 3 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG No data
1137036197_1137036207 30 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036207 16:35572123-35572145 AGTAGGGGAGTCACATCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137036197 Original CRISPR TATCTCTGTGCCCACCATTT AGG (reversed) Intergenic
No off target data available for this crispr