ID: 1137036201

View in Genome Browser
Species Human (GRCh38)
Location 16:35572096-35572118
Sequence TACAATGCCCTCTGTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137036192_1137036201 30 Left 1137036192 16:35572043-35572065 CCCGGACAAAAGAGAATAGTCAC No data
Right 1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG No data
1137036197_1137036201 3 Left 1137036197 16:35572070-35572092 CCTAAATGGTGGGCACAGAGATA No data
Right 1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG No data
1137036193_1137036201 29 Left 1137036193 16:35572044-35572066 CCGGACAAAAGAGAATAGTCACA No data
Right 1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137036201 Original CRISPR TACAATGCCCTCTGTGGGAA GGG Intergenic
No off target data available for this crispr