ID: 1137036853

View in Genome Browser
Species Human (GRCh38)
Location 16:35575314-35575336
Sequence CAGAGCAGCCCCAAAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137036853_1137036867 27 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036867 16:35575364-35575386 CCCTCGGTGTCTGCGGACGCGGG 0: 1
1: 0
2: 0
3: 3
4: 89
1137036853_1137036860 4 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036860 16:35575341-35575363 AAGGGTGAGCCAGGCAAGCCGGG No data
1137036853_1137036865 26 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036865 16:35575363-35575385 GCCCTCGGTGTCTGCGGACGCGG 0: 1
1: 0
2: 0
3: 9
4: 60
1137036853_1137036861 11 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036861 16:35575348-35575370 AGCCAGGCAAGCCGGGCCCTCGG 0: 1
1: 0
2: 2
3: 28
4: 238
1137036853_1137036858 -5 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036858 16:35575332-35575354 CTCTGAAAGAAGGGTGAGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 196
1137036853_1137036863 20 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036863 16:35575357-35575379 AGCCGGGCCCTCGGTGTCTGCGG 0: 1
1: 0
2: 2
3: 6
4: 134
1137036853_1137036869 28 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036869 16:35575365-35575387 CCTCGGTGTCTGCGGACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1137036853_1137036859 3 Left 1137036853 16:35575314-35575336 CCAGGCCCTTTGGGGCTGCTCTG 0: 1
1: 0
2: 2
3: 34
4: 283
Right 1137036859 16:35575340-35575362 GAAGGGTGAGCCAGGCAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137036853 Original CRISPR CAGAGCAGCCCCAAAGGGCC TGG (reversed) Intergenic
900391867 1:2437085-2437107 CAGGGCAGCCCCCATGGGTCAGG + Intronic
900702595 1:4057657-4057679 CAGAAAAGCCTCAAGGGGCCTGG - Intergenic
900785884 1:4650225-4650247 CAGGGAAGCCCCAAAGGGGAGGG - Intergenic
900858016 1:5201456-5201478 CAGAGGACCCCCATAGGCCCTGG - Intergenic
902386494 1:16078890-16078912 CATAGCAGCCACCATGGGCCAGG - Intergenic
903060430 1:20664907-20664929 CAGAGCAGCCTCGCAGAGCCTGG - Intronic
903132483 1:21289351-21289373 CAGTGCAGCCCCCCAGGGACGGG + Intronic
903971051 1:27119132-27119154 CAGAGCAGCCGCAGGGGGCTGGG - Intronic
905856327 1:41317060-41317082 CAGAGCAGACCCAAAGGCATAGG + Intergenic
905917938 1:41698829-41698851 AGGAGCAGCCCCACAGGCCCAGG - Intronic
906535484 1:46548807-46548829 CTGAGCAGCTCCATGGGGCCCGG - Intronic
906909026 1:49926105-49926127 CAGTGCAGTCCCAAAGGTGCTGG + Intronic
907394768 1:54181504-54181526 CAGAGCAGCAAAACAGGGCCCGG + Intronic
908071259 1:60462897-60462919 CAGAGGAGCCACAGAGGGGCAGG + Intergenic
911052243 1:93681228-93681250 CAGAGCAGCTCCGACGGGCAGGG + Intronic
912454607 1:109789156-109789178 CGTAGCAGCCCCAAAAGGGCAGG - Intergenic
912819478 1:112855259-112855281 CAGAGCAGCCCCAAAGGTGCTGG + Intergenic
913212391 1:116592401-116592423 CACAGCAGCCCCCAGAGGCCAGG + Intronic
915574238 1:156764932-156764954 CAGAGAAGCCCCTAAAGGACAGG - Intronic
915592342 1:156877937-156877959 CAGAGGAGCCCAAGAAGGCCAGG + Intronic
916752878 1:167739633-167739655 CAGAGAAGCCCCAGGGAGCCTGG + Intronic
922286539 1:224175739-224175761 CAGTGCAGCGCGAGAGGGCCGGG + Intronic
922776055 1:228214679-228214701 CAGAGCAGCCCCAAGAGAGCTGG + Intronic
923292571 1:232560680-232560702 CACAGCAGCCCCAAAGCCCTGGG + Intronic
923334226 1:232952935-232952957 CAGAGCAGGCCAGAAGAGCCAGG + Intronic
923567900 1:235090488-235090510 CTGAGCAGCTGCACAGGGCCTGG - Intergenic
1062902155 10:1154685-1154707 CAGAGCTGCCAGAAGGGGCCCGG - Intergenic
1063285658 10:4684945-4684967 CAGAGCAGCCCTGAAGAGCAGGG + Intergenic
1064283131 10:13969276-13969298 CATATCTGCCCCCAAGGGCCTGG + Intronic
1065134961 10:22658967-22658989 TTGAGCTGCCCCAAGGGGCCTGG - Intronic
1065464927 10:26009441-26009463 GAGAGCAGGCCCAAGGGGACTGG + Intronic
1067682757 10:48450892-48450914 CAGAACAGCCCCCACGGGGCCGG - Exonic
1067946763 10:50694497-50694519 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1068083304 10:52346649-52346671 CAGAGCGGCGACACAGGGCCAGG - Intergenic
1068083342 10:52346748-52346770 CACAGCAGCCCCCAGGGCCCTGG - Intergenic
1069637037 10:69931200-69931222 CAGAGCAGACCCAGAGTGGCAGG + Intronic
1069755336 10:70771323-70771345 AAGAGCAGCCCCAAGGGTTCAGG - Exonic
1070212037 10:74334438-74334460 CTGAGCATCCCCAAAGGACTTGG + Intronic
1070882072 10:79859490-79859512 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1071648647 10:87375801-87375823 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1073193858 10:101672206-101672228 CACAGCAACCCTAAAGGACCAGG + Intronic
1073739787 10:106393294-106393316 AAGAGCACCAGCAAAGGGCCAGG - Intergenic
1073989832 10:109250314-109250336 CAAAGCACACCCAAAGGGCGTGG + Intergenic
1074943261 10:118255399-118255421 CAGAGGATCCCCAAAGGCCTGGG + Intergenic
1075077494 10:119360810-119360832 CCCAGCATCCCCACAGGGCCTGG - Intronic
1075542339 10:123325380-123325402 CAGAGCACCCACAATGGCCCAGG - Intergenic
1075681893 10:124339240-124339262 CAGAGCTGCCCCAAGTGGGCTGG + Intergenic
1076436896 10:130452715-130452737 CAGACCAGCCTCCCAGGGCCAGG - Intergenic
1076691233 10:132224770-132224792 TAGATCAGCCCCAGAGGGCCAGG + Intronic
1077132736 11:981800-981822 CACAGCAGCCTCAGAGGGCAAGG - Intronic
1077170331 11:1163262-1163284 CAGAGCAGCCACACAGAGCAAGG - Intronic
1080012412 11:27472277-27472299 CAGAGCAGCCCTAGCGGGCCCGG + Exonic
1080251160 11:30235390-30235412 CATAGCAGCCCAAAAGGACTAGG - Intergenic
1083093359 11:60222765-60222787 AAGAGGAGCCCAAAATGGCCAGG - Intronic
1083419909 11:62546787-62546809 CAGAGCAGCTCCGAGTGGCCGGG + Exonic
1083642847 11:64154659-64154681 CACAGCAGGTACAAAGGGCCTGG - Intronic
1083744572 11:64728213-64728235 CAGAGCAGCCAGAAAGGGAAAGG + Intronic
1083942423 11:65903537-65903559 CACTGCAGCCCCAAAAGGCAGGG - Intergenic
1084004288 11:66315014-66315036 CACAGCAGCCCCAACAGCCCTGG - Exonic
1085859180 11:80212115-80212137 CAGAGGAGCCCCAGAGAGGCTGG - Intergenic
1086103835 11:83128841-83128863 CAGACCAGCCCCACAGACCCAGG + Intergenic
1086850584 11:91802923-91802945 CAGAGTTACCCCAAAGGCCCTGG + Intergenic
1087251443 11:95904705-95904727 CAGAGCAGCCCCAAGGGCTGTGG - Intronic
1089786202 11:120909075-120909097 CAGAGCAGACACCATGGGCCGGG + Intronic
1090241038 11:125182003-125182025 AAGTGCAGCCCCAAAGAGCCAGG - Intronic
1090639818 11:128720850-128720872 CAGAGAAGGCGCAGAGGGCCTGG - Intronic
1096238269 12:49944215-49944237 CTGAGCACCTCTAAAGGGCCAGG + Intergenic
1097166018 12:57087282-57087304 CAGCGCCGCCCCAAGGGGGCCGG + Intronic
1098865396 12:75757040-75757062 GAAAGCAGCCCCAATGGGCATGG + Intergenic
1102898805 12:116620170-116620192 CAGTGCAGGCTCAAAGGCCCTGG + Intergenic
1102954631 12:117051583-117051605 CAGAGCAGCCCGATAAGTCCGGG - Intronic
1103506693 12:121445808-121445830 CAGAAAAGCCCCAAAGGAGCAGG + Intronic
1103914549 12:124369661-124369683 CAAAGCAGGCCCCAAGGGCGGGG + Intronic
1104371107 12:128224712-128224734 CAGAGCAGCCCCAAGGGCTGCGG - Intergenic
1104917252 12:132272094-132272116 CAGAGCAGCCCCAGAGCGGTCGG + Intronic
1104972007 12:132534965-132534987 CAGGACAGCCCCACAGGGCAGGG + Intronic
1105215637 13:18283024-18283046 CACAGCAGCCCCCAGGGACCAGG + Intergenic
1105780497 13:23701848-23701870 GAAAGCAACCGCAAAGGGCCAGG + Intergenic
1106100046 13:26686706-26686728 CAGAGCTGCGGCACAGGGCCTGG + Exonic
1109284830 13:60397531-60397553 CGGAGCCGGCCCGAAGGGCCCGG - Intronic
1112182962 13:97103458-97103480 CAGAGCACCCAGACAGGGCCAGG - Intergenic
1113553387 13:111211153-111211175 CACAGCAGCCCCGAGAGGCCTGG + Intronic
1118590189 14:67395316-67395338 CAGAGCCCCCCCAAGGGGCAGGG + Intronic
1118723788 14:68612452-68612474 CAGAGCTGGCCCATAGGACCAGG - Intronic
1119188452 14:72661721-72661743 CAGAGCTGTCCCCAAGGGCTAGG - Exonic
1119249062 14:73136648-73136670 CCGGGCGGCCACAAAGGGCCGGG - Intronic
1122366875 14:101199521-101199543 CGGAGCAGCCCCAGAAGTCCAGG + Intergenic
1122503902 14:102219538-102219560 AAGCGAAGGCCCAAAGGGCCCGG - Intronic
1123033378 14:105461569-105461591 GGGAGGAGCCCCAAAGGGGCCGG + Intronic
1124613488 15:31224926-31224948 CAGAGCAGCCCCAAGGGCTGTGG - Intergenic
1127683783 15:61322174-61322196 CAGAGCTACCCCACAGGACCAGG - Intergenic
1127804896 15:62510201-62510223 CAGTGCTGACCCAAAGGGGCTGG - Intronic
1128745399 15:70110818-70110840 CAGAGCTGCCTCAAAAGGGCTGG - Intergenic
1129883934 15:79025726-79025748 CAAAGGAACCCCAAAGGGCATGG + Intronic
1130460896 15:84157730-84157752 GAGAGGAGCCCCAGAGGACCTGG - Intergenic
1131174373 15:90201073-90201095 CAGAGGAGCCGGAAGGGGCCAGG + Intronic
1132375543 15:101326061-101326083 CAAGGCTGCCCCAGAGGGCCTGG - Intronic
1132613992 16:831454-831476 CACAGCAGGCCCACAGGCCCAGG - Intergenic
1132693163 16:1190683-1190705 CAGAGCTGCCCCACAGGCACAGG + Intronic
1133099369 16:3469988-3470010 CAGGGCAGCCCCAGCAGGCCCGG - Intronic
1133391999 16:5418310-5418332 CCGAGATGCCCCCAAGGGCCAGG - Intergenic
1135548244 16:23379807-23379829 CAGAGATGCCCAGAAGGGCCGGG + Intronic
1135633233 16:24052472-24052494 CAGAGCAGCCCTAAAGCTGCTGG + Intronic
1136465621 16:30441523-30441545 GAAAGTAGCCCCAAAAGGCCAGG - Intergenic
1137036853 16:35575314-35575336 CAGAGCAGCCCCAAAGGGCCTGG - Intergenic
1137508270 16:49075811-49075833 GAGAGCAGCTGCTAAGGGCCTGG - Intergenic
1137720470 16:50624810-50624832 CAGGGCAGCCCTGAAGAGCCTGG - Intronic
1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG + Intergenic
1139773984 16:69302066-69302088 CACTGCTGCCACAAAGGGCCAGG - Exonic
1140201295 16:72896999-72897021 CAGAGCAGCCCCTCTGAGCCAGG + Intronic
1141054909 16:80804942-80804964 CCGCGCAGCCCCGAGGGGCCAGG - Intergenic
1141641081 16:85341923-85341945 CTGAGCATCCCCAAAGGCCCAGG - Intergenic
1141647703 16:85376395-85376417 CAGCCCAGCCCTAATGGGCCGGG - Intergenic
1141935375 16:87234924-87234946 CACAGCAGCCCAAATGGGCAGGG - Intronic
1141944145 16:87298061-87298083 CATAGAAGCCCCAGAAGGCCAGG - Intronic
1142708812 17:1712486-1712508 CAGAGGAGCCCCTAAAGGCCAGG - Intergenic
1143158928 17:4856483-4856505 CACAGCTGCCGCACAGGGCCTGG + Intronic
1143213032 17:5203548-5203570 CGGAGCACCGCCAAAGGGGCAGG + Intergenic
1143329362 17:6122043-6122065 CAGAGCAGGACCATGGGGCCTGG - Exonic
1145974572 17:28976770-28976792 CAGGGCAGCCTTCAAGGGCCAGG + Intronic
1146275661 17:31514152-31514174 GAGAGCAGCCTCAAATGGCTTGG - Intronic
1147133140 17:38420422-38420444 CAGAACAGCCCCAAAGAACTTGG - Intergenic
1147965196 17:44190928-44190950 CAGAGCTGGGCCCAAGGGCCGGG + Exonic
1148103929 17:45109329-45109351 CAGAGCAGCCCCCTTGGTCCAGG + Exonic
1148338831 17:46861127-46861149 CAGAGCTGCCCTAAGGGGACAGG - Intronic
1148565797 17:48632233-48632255 CTGAACAGCCCAACAGGGCCAGG + Intronic
1148736601 17:49868633-49868655 GAGAGGAGCATCAAAGGGCCAGG - Intergenic
1149984379 17:61336076-61336098 CAGAGCAGCACCACTGGGCCAGG - Intronic
1152039671 17:77894666-77894688 CCCATCAGCCCCAACGGGCCAGG + Intergenic
1152275314 17:79353188-79353210 CACAGCAGCCGCAGAGGCCCTGG - Intronic
1152352233 17:79790363-79790385 CACAGGAGCCCCAGAGGGCCGGG + Intergenic
1152623720 17:81379052-81379074 AACTGCAGCCCCAAGGGGCCTGG - Intergenic
1153775819 18:8452551-8452573 CAGAGCAGCTCAGAAGGGACGGG - Intergenic
1154209219 18:12365125-12365147 CAGAGCAATCCCAGAGGGGCTGG + Intronic
1155062531 18:22241564-22241586 AAGCGCAGCCACCAAGGGCCGGG - Intergenic
1157422525 18:47558715-47558737 CAGTCCATCCCCAGAGGGCCGGG - Intergenic
1157499652 18:48180557-48180579 CAGCACAGCCCCAAGGGCCCAGG + Intronic
1157519891 18:48338238-48338260 CAGTGCAGCCCCAAACGCCCAGG + Intronic
1160566638 18:79790138-79790160 CAGAGCACCGCCAAAAGCCCCGG + Intergenic
1160974998 19:1788845-1788867 CAGGGCATCCCCAGAGGCCCTGG + Intronic
1161072997 19:2271543-2271565 CAGAGCAGCCCCAGCAGGCCCGG - Intronic
1161195343 19:2983363-2983385 GAGAGCAGCCCCAAGGGGATTGG + Intronic
1161514575 19:4689493-4689515 CAGAGCAGTCCCTCATGGCCCGG - Intronic
1161597169 19:5156445-5156467 CAGAGCTGCCTCATGGGGCCAGG - Intergenic
1161619351 19:5290163-5290185 CAGTGCAGCCCCTGAGAGCCAGG - Intronic
1162018882 19:7859814-7859836 CAGAGGAGCCACATGGGGCCTGG + Intronic
1162294254 19:9802230-9802252 AAGACCAGCCCCAGAAGGCCGGG - Intergenic
1162797355 19:13093869-13093891 CAGGGCAGACCCCAAGGGTCTGG - Intronic
1163487665 19:17598235-17598257 CAGAGCAGCCCCAAGGCTGCTGG + Intergenic
1163640213 19:18457853-18457875 CTGGGCATCCCCACAGGGCCTGG - Intronic
1165070282 19:33251519-33251541 CAGGGCAGCCCCGATGGGCCAGG - Intergenic
1165233772 19:34404482-34404504 CACGGCAGCCCCACAGGGCCGGG + Exonic
1165299959 19:34962515-34962537 ATGAGCAGTCCCAAATGGCCAGG - Intronic
1165471975 19:36009233-36009255 CACAGCAGCCCCAAAGGGGCAGG + Exonic
1167174207 19:47854119-47854141 AAAAGCAGCCCCCAATGGCCAGG + Intergenic
1167418781 19:49390737-49390759 CAGAGCAGCCACCAAGGGTCGGG - Intronic
1167847885 19:52179257-52179279 AAGAGCAGCCCAGAAGGGACTGG - Intergenic
1167853651 19:52220869-52220891 CAAAGCAGCCCCTAGGTGCCAGG - Intronic
1168016093 19:53574337-53574359 AAGAGCATCCCCACAGGGCAGGG + Intronic
1168405729 19:56109293-56109315 CAGTGCAGCCCCAAAGGCACGGG + Intronic
924959554 2:21788-21810 TAGAGCAGCCCCAAAGAGGAAGG - Intergenic
925266617 2:2570713-2570735 CAGAGCAGCCACCCATGGCCTGG - Intergenic
925274260 2:2637665-2637687 CAGTGGAGCACCAGAGGGCCTGG + Intergenic
926706153 2:15839045-15839067 TGGAGTAGCCCCAAAGGGACAGG + Intergenic
927693901 2:25227335-25227357 CAGGGCGAGCCCAAAGGGCCGGG - Intergenic
927940787 2:27101648-27101670 CAGAGAAGAAGCAAAGGGCCAGG - Exonic
928784347 2:34864240-34864262 CAGAGCAGTCCCTAAGTGCCAGG + Intergenic
929081964 2:38130027-38130049 CAGAGCCTCCCCAAGGGGACAGG - Intergenic
929532921 2:42763688-42763710 GGCAGCAGCCCCAAAGCGCCAGG + Exonic
929759003 2:44790730-44790752 CAGACTCCCCCCAAAGGGCCAGG - Intergenic
929994572 2:46817314-46817336 AAGAGAAGCCCCACAGAGCCAGG - Exonic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
931217260 2:60257678-60257700 CCGAGAAGGGCCAAAGGGCCTGG - Intergenic
931426603 2:62177358-62177380 CAGAGCAGCCTCCCAGGGCAGGG + Intergenic
931721934 2:65072827-65072849 CAGAGGAGACCCCGAGGGCCTGG - Exonic
931754634 2:65361893-65361915 CAGCAGAGCCCCACAGGGCCAGG + Intronic
931835889 2:66097963-66097985 GAGGGCAGCCCTAGAGGGCCTGG + Intergenic
932496998 2:72150610-72150632 GAGATCAGCTCCAAAGGGCCGGG + Intergenic
932564602 2:72897974-72897996 CAGAACAGCCACAAAATGCCAGG + Intergenic
934298693 2:91763701-91763723 CACAGCAGCCCCCAGGGGCCAGG - Intergenic
935199658 2:100845230-100845252 ATGATCAGCCCCAAATGGCCAGG - Intronic
935621616 2:105135143-105135165 CTGAGGAACCCCAAATGGCCAGG - Intergenic
935625606 2:105169917-105169939 CATGGCAGCAGCAAAGGGCCTGG + Intergenic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
936515012 2:113175862-113175884 CTGAGCACCCACCAAGGGCCAGG + Intronic
937053101 2:118908174-118908196 CAGAGAAGCCCCCATGGCCCAGG - Intergenic
937643350 2:124238010-124238032 CAAAGCAGCCTCAATGGGCCAGG - Intronic
938809271 2:134837238-134837260 TAGAGCACTCCCAATGGGCCAGG - Intergenic
939874131 2:147556997-147557019 CAGAGCAGCCTCAACGGAGCAGG + Intergenic
941091589 2:161182673-161182695 CATAGAAGCCCCAAAGGACAGGG - Intronic
946334710 2:219029162-219029184 CACAGCAGCAGCAAAGCGCCTGG + Intronic
946963480 2:225010323-225010345 GAGGGCACCCCCAAAGGGCCTGG + Intronic
947984724 2:234438391-234438413 CAGGGCAGCACCCAAGGCCCTGG - Intergenic
948865351 2:240772198-240772220 GATATCAGCACCAAAGGGCCAGG - Intronic
948967559 2:241395199-241395221 CTCAGGAGCCACAAAGGGCCTGG + Intronic
1169193290 20:3670874-3670896 GAGAGCAGCCCCAGAGGCCATGG - Intronic
1170477946 20:16735058-16735080 CAGACCAGCCAGAAAGAGCCTGG + Intronic
1170572614 20:17641040-17641062 CTGACCAGTCCCAGAGGGCCAGG + Intronic
1172168521 20:32914048-32914070 AATTGCAGCCCCACAGGGCCAGG - Intronic
1172392495 20:34575361-34575383 CAGAGCACCCCCAGAGGTACTGG + Intronic
1173466777 20:43289439-43289461 CAGGGCAGCGCCACAGGGGCAGG - Intergenic
1173574694 20:44104793-44104815 CAGTGCAGCCCAAAAGGATCAGG + Intergenic
1174396586 20:50250563-50250585 CAGAGCAGCCTAAGAGAGCCAGG - Intergenic
1174572136 20:51509327-51509349 CACATCAGCTCCACAGGGCCAGG + Intronic
1175287097 20:57844301-57844323 CTGAGCAGCCTCAGAGGGCCTGG - Intergenic
1175330143 20:58158049-58158071 CAGAGCAGGCCCAGGGGCCCTGG - Intronic
1175391354 20:58629400-58629422 CAGAGCAGCCCCCACTGGGCTGG + Intergenic
1175936034 20:62514429-62514451 CACAGAAGCCCCAAGAGGCCAGG - Intergenic
1178591003 21:33909994-33910016 CAGAGCGGCCCCAAAGAGTCTGG + Intronic
1180013279 21:45065384-45065406 CACAGCAGCCCCCCATGGCCAGG + Intergenic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180167630 21:46038206-46038228 CAGTCCAGCCCAGAAGGGCCTGG + Intergenic
1180993991 22:19955462-19955484 CGGATCAGCCCCAAAGGGCAGGG + Intronic
1181306930 22:21922455-21922477 GAGAGCAGCCCGGAAGGCCCTGG + Exonic
1182005049 22:26952864-26952886 CAGAGCTGCCCCCAAGGCCTTGG - Intergenic
1182395569 22:30033550-30033572 CAGACCACCCCCAAGGGGCCAGG - Intergenic
1182749252 22:32628487-32628509 AAGTGCAGCCCCAAAGAGGCTGG + Intronic
1182797413 22:33000853-33000875 CAGGGCAGCCCCACAATGCCTGG - Intronic
1183468013 22:37989836-37989858 TGGAGCAGGCCCAAAGGCCCAGG - Intronic
1183720964 22:39561107-39561129 CACAGCAGCTCCAAAAGGGCAGG - Intergenic
1183928802 22:41224626-41224648 CAGAGCAGCCCCACATTCCCAGG + Intronic
1183933457 22:41248897-41248919 CAGCGCAGGCCAAAGGGGCCTGG - Intronic
949879076 3:8647800-8647822 GAGTTCTGCCCCAAAGGGCCTGG + Intronic
950151392 3:10690066-10690088 CAGAGCAGACACAAAGGCTCTGG + Intronic
950776588 3:15355695-15355717 CAGAGCAGCCCTAAGTGCCCGGG + Intergenic
954497838 3:50982572-50982594 GAGAGCAGCAACACAGGGCCAGG - Intronic
956037812 3:65114403-65114425 CAGAGCATCCCCATGGTGCCAGG + Intergenic
962168603 3:133077165-133077187 CAGCACAGCCCCAAACGGCCAGG - Intronic
962631318 3:137279100-137279122 CAGGGAAGCCCTTAAGGGCCTGG + Intergenic
963369534 3:144381005-144381027 CAATGCAGTTCCAAAGGGCCAGG - Intergenic
965790252 3:172379644-172379666 CAAAGCTGCACCAAAGGGCCAGG - Intronic
968448306 4:663485-663507 CTGAGCGGCCCCCAAGGACCTGG + Intronic
969172592 4:5376114-5376136 CAGAGCACCCCCACAGGACCTGG - Intronic
970914663 4:21319113-21319135 TAGAGCAGGCCCTAAGTGCCAGG - Intronic
979114154 4:116799755-116799777 CACCGCAGCCCCAAATGGCTAGG - Intergenic
981550355 4:145936878-145936900 CCGAGCAGCGCCAAACCGCCGGG + Intronic
984953625 4:185024510-185024532 CTGAGCATCCCCTATGGGCCAGG - Intergenic
985614091 5:909183-909205 CAGCCCAGCCTCACAGGGCCAGG + Intronic
988536313 5:32072323-32072345 CAGGGGTGCCCCAGAGGGCCTGG + Intronic
990327996 5:54697036-54697058 CAGAGGAGCACAAAAGGGCAGGG + Intergenic
990472363 5:56127775-56127797 CAGTGCAGCCACAGAGGGTCTGG - Intronic
995443985 5:112222690-112222712 TAAAGCAGCCCCAAAAGGCTTGG + Intronic
997379181 5:133423200-133423222 CAGAGCAGTCAAAAGGGGCCAGG - Intronic
997599795 5:135131487-135131509 CACAGCAACCCCAAAGGGGCTGG - Intronic
998044361 5:138974345-138974367 TAGAGCAGGCCCAAAGGGGGAGG - Intronic
999424819 5:151478000-151478022 CAAAGCAGCCCCAAAGCCTCTGG - Intronic
999708257 5:154293563-154293585 GAGAGCAGCCCCCAGGGGCTGGG - Intronic
1001527775 5:172440905-172440927 CACAGCAGCCCCCAAGAGACAGG - Intronic
1002193815 5:177491836-177491858 CGGGGGCGCCCCAAAGGGCCGGG + Exonic
1002602721 5:180363207-180363229 CAGCTCAGCACCAAAGGGCATGG + Intergenic
1002799286 6:505657-505679 CAGAGCTGCCCCAGTGGGACCGG - Intronic
1005379390 6:25218015-25218037 AGGAGAAGCCCCAAAAGGCCAGG - Intergenic
1006520231 6:34567086-34567108 TAAAGCTGCCCCACAGGGCCTGG + Intergenic
1006716428 6:36123607-36123629 CTGAGCAGCTACAATGGGCCAGG + Intergenic
1007029223 6:38612939-38612961 CATTGCAGCTCCAAAGGGACAGG - Intronic
1007695032 6:43726387-43726409 GAGAGGAGCCCCAACGTGCCAGG - Intergenic
1008502937 6:52201381-52201403 CAGATCAGGTACAAAGGGCCAGG + Intergenic
1009469578 6:64016068-64016090 CAGAGCAGCCCAAAGGTACCAGG - Intronic
1013267981 6:108518946-108518968 CAGACCAGCTCCAAACAGCCAGG + Intronic
1016902060 6:149113053-149113075 CTGAGCAGCACCAAAGAGCATGG - Intergenic
1017653123 6:156601271-156601293 GAGAGCATCCCCAGAGGGCTGGG - Intergenic
1018427412 6:163695845-163695867 CAGGGAAGCCCCAAAGGGATAGG - Intergenic
1019061247 6:169259738-169259760 CATAGGAGCCCCAAAGGGCAGGG - Intergenic
1019306993 7:340328-340350 CAGGACAGCCCCAAAGTGCCAGG - Intergenic
1019331993 7:464819-464841 CAGGGCAGCCCCAAGGCGCCAGG - Intergenic
1019372814 7:671850-671872 CACAGCTGCAGCAAAGGGCCTGG - Intronic
1019525708 7:1479560-1479582 CAGGGCAGCCCCGAGGTGCCGGG - Exonic
1019610299 7:1933320-1933342 CCGAGCAGCCCAGAAGGACCTGG - Intronic
1019754209 7:2756861-2756883 CAGACCAACCTCAAATGGCCTGG - Intronic
1021682556 7:23149143-23149165 CAAAGCCACCACAAAGGGCCAGG + Intronic
1023984497 7:45086964-45086986 CAGAGAAGGCCCACAGGGCAGGG - Intronic
1024006151 7:45225993-45226015 GAGAGCAACCCCCAAAGGCCAGG - Intergenic
1025209497 7:57012818-57012840 CAGTGCAGTCCCCAAGGGGCAGG + Intergenic
1025241711 7:57282103-57282125 CAGAGCAGCCCCGAGGGCCATGG - Intergenic
1025662450 7:63564032-63564054 CAGTGCAGTCCCCAAGGGGCAGG - Intergenic
1026904477 7:74055030-74055052 CAGAGGAGCCCAAAACTGCCTGG + Intronic
1031055359 7:116987369-116987391 CACAGCAGGCCCAAAGGCCCAGG - Intronic
1032093005 7:128921195-128921217 CTGAGCAGCCCCAGTGGGCGGGG + Intergenic
1032364514 7:131286808-131286830 AAAAGGAGCCCCAATGGGCCAGG + Intronic
1032760254 7:134933869-134933891 CAGAGGAGAGGCAAAGGGCCAGG + Exonic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1034282793 7:149865439-149865461 TAGAGCAGGCCCAAAGTCCCTGG - Exonic
1035021065 7:155800800-155800822 CAGAGCAGACCCTCAGGGACTGG + Exonic
1035302965 7:157909508-157909530 CAGGGCAGCAGCCAAGGGCCAGG - Intronic
1035320275 7:158024631-158024653 CAGATCAGCCCCATGGGGTCAGG - Intronic
1035397368 7:158543988-158544010 CAGGGCAGCCCCAACTGGCCGGG + Intronic
1036604524 8:10293769-10293791 CACAGGAGCCCCAGAGGGCAAGG - Intronic
1036658456 8:10692409-10692431 CAGAGCAGGCCCCAAAGGCCAGG - Intronic
1038456212 8:27673395-27673417 CAGACCTGCCCCAAGGGGCCTGG + Intronic
1040979832 8:53234979-53235001 CAGCACATCCCCAAAAGGCCAGG + Exonic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043927671 8:86056215-86056237 CAGTGCAGCCCCAAACTCCCTGG - Intronic
1044865928 8:96571308-96571330 CAGAGCGGCTGCAAAGGCCCTGG + Intronic
1045252962 8:100496576-100496598 CAGAACAGCCCCCAAGGCCATGG - Intergenic
1045336079 8:101205465-101205487 CAGTGCAGCGCGAGAGGGCCGGG + Intronic
1046266401 8:111836977-111836999 CAGAGCAGCCCCAGTGACCCGGG + Intergenic
1048338381 8:133520092-133520114 CTGAGCAGCTGCAATGGGCCAGG + Intronic
1048989009 8:139750470-139750492 CAGAGGAGCACCTTAGGGCCAGG + Intronic
1049758218 8:144320227-144320249 CAGGGCTGGGCCAAAGGGCCAGG + Intronic
1050119708 9:2295807-2295829 CAGAGCTGCCAAGAAGGGCCTGG + Intergenic
1053056667 9:34997022-34997044 CAGTGCAGCCACACAGCGCCTGG - Exonic
1057570071 9:96197695-96197717 CAGAGGAGCCACAAGGGGCTGGG + Intergenic
1057571828 9:96210033-96210055 CAGAGCAGCTCCACATGGCAGGG + Intergenic
1057887376 9:98840172-98840194 CAGAGCAGACCCAGAGGCCAGGG - Intronic
1058425425 9:104871459-104871481 CAGTGCAGCCCCAGAGGGAAAGG + Intronic
1061133694 9:128721800-128721822 CACAGCAGCCCCTGAGGGCTCGG - Exonic
1061366121 9:130173019-130173041 CAGAGCTGTCCCAACGGGCAGGG + Intronic
1061378684 9:130241337-130241359 CAGGGCAGCCCCTGAGGACCGGG + Intergenic
1061393494 9:130330686-130330708 AAGAGCCGCTCCAAAGGGACTGG - Intronic
1062105045 9:134750673-134750695 CAGCGCAGCCTCAGAGGGTCTGG - Intronic
1062446872 9:136598858-136598880 CTGAGCAGCCCAACAGGCCCAGG - Intergenic
1062516255 9:136938074-136938096 CAGAGCAGCCCTAAGGGCCAGGG - Intronic
1186680449 X:11868206-11868228 GAGAGGAGACCCAAAGGGACTGG - Intergenic
1187243605 X:17534902-17534924 CAGGGCAGGCCCAGAGTGCCTGG + Intronic
1187392775 X:18896701-18896723 CAGAGCAGCACCTACAGGCCTGG - Intronic
1192443593 X:71193519-71193541 CAGAGCAGCCCCAAACTTGCTGG - Intergenic
1192795240 X:74420725-74420747 CGGAGGAGCCTCAGAGGGCCGGG - Intergenic
1198170264 X:134098351-134098373 CAGAGGAGCCCAAAGTGGCCAGG - Intergenic
1202378357 Y:24257450-24257472 GAGAGAAGCCCCAGAGGACCTGG + Intergenic
1202492425 Y:25412671-25412693 GAGAGAAGCCCCAGAGGACCTGG - Intergenic