ID: 1137038883 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:35591703-35591725 |
| Sequence | GAGAAATCCCACCGACCCTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1137038882_1137038883 | -7 | Left | 1137038882 | 16:35591687-35591709 | CCTCTCTGCACACAGGGAGAAAT | No data | ||
| Right | 1137038883 | 16:35591703-35591725 | GAGAAATCCCACCGACCCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1137038883 | Original CRISPR | GAGAAATCCCACCGACCCTG TGG | Intergenic | ||