ID: 1137038883

View in Genome Browser
Species Human (GRCh38)
Location 16:35591703-35591725
Sequence GAGAAATCCCACCGACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137038882_1137038883 -7 Left 1137038882 16:35591687-35591709 CCTCTCTGCACACAGGGAGAAAT No data
Right 1137038883 16:35591703-35591725 GAGAAATCCCACCGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137038883 Original CRISPR GAGAAATCCCACCGACCCTG TGG Intergenic