ID: 1137043277

View in Genome Browser
Species Human (GRCh38)
Location 16:35633680-35633702
Sequence AAATGTTGGCAAGAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137043277_1137043280 0 Left 1137043277 16:35633680-35633702 CCTCCATACTCTTGCCAACATTT No data
Right 1137043280 16:35633703-35633725 GTTGTTTGTGTTGTAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137043277 Original CRISPR AAATGTTGGCAAGAGTATGG AGG (reversed) Intergenic
No off target data available for this crispr