ID: 1137044611

View in Genome Browser
Species Human (GRCh38)
Location 16:35643561-35643583
Sequence AAGAGCATGGTGAAGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137044603_1137044611 18 Left 1137044603 16:35643520-35643542 CCCTTGTATAAGTGACATTTTAC No data
Right 1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG No data
1137044604_1137044611 17 Left 1137044604 16:35643521-35643543 CCTTGTATAAGTGACATTTTACA No data
Right 1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG No data
1137044606_1137044611 -9 Left 1137044606 16:35643547-35643569 CCACGTTAAATGATAAGAGCATG No data
Right 1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG No data
1137044602_1137044611 19 Left 1137044602 16:35643519-35643541 CCCCTTGTATAAGTGACATTTTA No data
Right 1137044611 16:35643561-35643583 AAGAGCATGGTGAAGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137044611 Original CRISPR AAGAGCATGGTGAAGTGGTG GGG Intergenic
No off target data available for this crispr