ID: 1137047828

View in Genome Browser
Species Human (GRCh38)
Location 16:35685141-35685163
Sequence GTCTCATCCATTAGAATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137047820_1137047828 29 Left 1137047820 16:35685089-35685111 CCTGGGGTTGGCCCAGAATCTTT No data
Right 1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG No data
1137047825_1137047828 -6 Left 1137047825 16:35685124-35685146 CCTGGGATCGCCCAATAGTCTCA No data
Right 1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG No data
1137047822_1137047828 17 Left 1137047822 16:35685101-35685123 CCAGAATCTTTCTCATTAGAATG No data
Right 1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG No data
1137047821_1137047828 18 Left 1137047821 16:35685100-35685122 CCCAGAATCTTTCTCATTAGAAT No data
Right 1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137047828 Original CRISPR GTCTCATCCATTAGAATGTG TGG Intergenic
No off target data available for this crispr