ID: 1137052015

View in Genome Browser
Species Human (GRCh38)
Location 16:35722439-35722461
Sequence CATCTCTGTGGAGCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 7, 3: 28, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137052015 Original CRISPR CATCTCTGTGGAGCACAGGC TGG (reversed) Intergenic
900460969 1:2801969-2801991 CATCTATGTGGAGAGGAGGCTGG - Intergenic
901013166 1:6212218-6212240 CCTCTCTGTGCAGCACCTGCAGG + Exonic
901149048 1:7088141-7088163 CATCTCTGTTGTGCTCAGGTTGG - Intronic
901483845 1:9544296-9544318 TCTCTCTGTGTAGCCCAGGCTGG + Intronic
901853511 1:12030235-12030257 CAAGTCTCTGGAGCACAGCCTGG + Intronic
902459600 1:16563715-16563737 CATAACTGTGCAGCACATGCCGG - Exonic
903570337 1:24299810-24299832 CATCACTGTGTTGCCCAGGCTGG + Intergenic
903709005 1:25308005-25308027 CATGCCTGTAGAGAACAGGCAGG + Intronic
903771155 1:25765297-25765319 CAGCTCTGGGAAGCAGAGGCAGG + Intronic
905946655 1:41907038-41907060 CTTCTCTGTGGGTCACTGGCTGG - Intronic
906301198 1:44682969-44682991 CATCACTGTGGAGTTTAGGCTGG + Intronic
907321070 1:53602636-53602658 CATCCCTGTGGGGCAGGGGCAGG + Intronic
907490327 1:54805299-54805321 CATGGCTGTGGAGCACTGGTTGG + Intergenic
908033221 1:60023836-60023858 CAGTTTTGTGGAGCACTGGCTGG + Intronic
911638061 1:100257936-100257958 TCTCTCTGTGGTGCTCAGGCTGG + Intergenic
912204113 1:107491960-107491982 CATTTAGCTGGAGCACAGGCTGG - Intergenic
912328804 1:108797440-108797462 GCTCTCTCTGTAGCACAGGCTGG + Intronic
912951783 1:114125290-114125312 CATGTCTGGCCAGCACAGGCTGG - Intronic
913605986 1:120466427-120466449 CATAACTGTGCAGCACATGCCGG + Intergenic
913644174 1:120840799-120840821 CATAACTGTGCAGCACATGCCGG + Intronic
914177469 1:145291298-145291320 CATAACTGTGCAGCACATGCCGG - Exonic
914210442 1:145573737-145573759 CATAACTGTGCAGCACATGCCGG - Intergenic
914269365 1:146066090-146066112 CATAACTGTGCAGCACATGCCGG - Exonic
914367729 1:146994781-146994803 CATAACTGTGCAGCACATGCCGG + Exonic
914485250 1:148103441-148103463 CATAACTGTGCAGCACATGCCGG - Exonic
914532198 1:148532777-148532799 CATAACTGTGCAGCACATGCCGG - Exonic
914585213 1:149055428-149055450 CATAACTGTGCAGCACATGCCGG - Exonic
914636196 1:149554944-149554966 CATAACTGTGCAGCACATGCCGG + Intergenic
914812206 1:151037187-151037209 CAGCTCGGTGGAGGAAAGGCAGG + Intronic
915780782 1:158547654-158547676 CAGCTCTGTGGCACACTGGCTGG - Exonic
916061409 1:161101227-161101249 CATCGCTGTGTCGCCCAGGCTGG + Intronic
916171036 1:162001979-162002001 CAGCTCTGTGGAGGACAGAGTGG - Intronic
917358645 1:174153146-174153168 CATCTCTATGTTGCCCAGGCTGG - Intergenic
917442848 1:175082207-175082229 CATCTCTGTGCTGCACTGGGAGG - Intronic
917519325 1:175735057-175735079 CATCTCTCTGTGGCACAGACTGG + Intronic
917853311 1:179082883-179082905 CATCACTGTAGAGCACCGGATGG + Intronic
918894469 1:190322415-190322437 CATCTCTGTGGAGCACATTTAGG - Intronic
920532158 1:206711277-206711299 CATCTCTCTGTCGCCCAGGCTGG + Intronic
920659362 1:207902357-207902379 CATCTCTGTAGAGAAAAGGATGG + Intronic
920716133 1:208342156-208342178 CATCTCAGTGGAGCACTGAGAGG + Intergenic
921170408 1:212542475-212542497 CCTCTCTGTGTCGAACAGGCTGG - Intergenic
921362409 1:214342146-214342168 GTTCTTTGTGGAGCACTGGCTGG - Intergenic
921380161 1:214516440-214516462 CATCACTGTGCAGCATATGCTGG + Intronic
921958930 1:221013712-221013734 AATCTATGTGGAGGAAAGGCAGG - Intergenic
923880473 1:238098800-238098822 TATCTCTCTGCAGCCCAGGCTGG + Intergenic
924331743 1:242946593-242946615 TTTCTCTGTGTACCACAGGCAGG - Intergenic
924819596 1:247476136-247476158 CATCACTGTGTTGCCCAGGCTGG - Intergenic
1063080849 10:2765891-2765913 CCTCTCTCAGGAGCACAGGGAGG - Intergenic
1063296214 10:4809363-4809385 CAACTTTGTGGAGCACTGGCTGG + Intronic
1064255328 10:13738460-13738482 CAGCTCCGGGGAGCACAGGCTGG + Intronic
1064335393 10:14436065-14436087 CATCTCTGTGTTGCAATGGCCGG + Intronic
1064901729 10:20302396-20302418 CCTCACTGTGTTGCACAGGCTGG - Intergenic
1066043599 10:31577852-31577874 CAGGTCTGTGGGGCTCAGGCTGG - Intergenic
1066256713 10:33686670-33686692 CATCTCTCTGGATCACAGCTGGG - Intergenic
1067657767 10:48210212-48210234 TATCTCTCTGTACCACAGGCAGG + Intronic
1067772942 10:49140240-49140262 CATCTCTCTGCAGGACAGGCTGG - Intergenic
1067858139 10:49815469-49815491 CTTCTCTGAGAAGAACAGGCTGG - Intergenic
1069851339 10:71407233-71407255 CCTCTCTGTGGATCCCAGGTGGG - Intronic
1069876669 10:71567402-71567424 CCACTCTGTGGAGTAGAGGCAGG - Intronic
1072425607 10:95327722-95327744 CATCTCTGTGAGACTCAGGCAGG - Intronic
1072974556 10:100046440-100046462 GTTCTCTGTGTAGCCCAGGCTGG - Intronic
1074403045 10:113157621-113157643 CATCTTTGAGGAGCACATGAAGG - Intronic
1075769382 10:124919947-124919969 CATCACTGTGTTGCCCAGGCTGG + Intergenic
1076204861 10:128588903-128588925 CCTCTCTGTGAAGCAGAGGCAGG - Intergenic
1076921593 10:133457261-133457283 GCCGTCTGTGGAGCACAGGCCGG - Intergenic
1077227085 11:1443161-1443183 CAGCTCTGTGGGGCCCAGGGTGG + Intronic
1078971042 11:16411581-16411603 CATCTCTCTTAAGCACAGGCTGG - Intronic
1079092496 11:17490942-17490964 CAGCTCTCTGGAGGCCAGGCTGG - Intergenic
1079364382 11:19796650-19796672 CCTCTCTGTGGAGGGAAGGCTGG + Intronic
1084444248 11:69194278-69194300 CAGCTCTGAGCAGCACAGGGCGG - Intergenic
1085104227 11:73828252-73828274 AATCTCTCTGCCGCACAGGCTGG + Intronic
1085468449 11:76740054-76740076 CATGGGTGTCGAGCACAGGCAGG + Intergenic
1088112941 11:106282797-106282819 GATCTCTGTAGAGAAGAGGCTGG - Intergenic
1088619066 11:111663613-111663635 CTTCTGTGTGGAGAACAGACTGG + Intronic
1089098672 11:115941221-115941243 CAGCTCTGTGGAGCCCAAACCGG - Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091704196 12:2682657-2682679 CATCTCTGTGGAGAGCAGGCTGG - Exonic
1091710887 12:2739602-2739624 CATCTCTGTGGAGAGCAGGCTGG - Intergenic
1091793188 12:3283186-3283208 CATATCTGGAGAGCGCAGGCAGG - Exonic
1091947978 12:4565953-4565975 CATCTCTGTGAAGTAAAGGAAGG + Intronic
1092170417 12:6370696-6370718 CACGTCTGGGGACCACAGGCAGG + Intronic
1092547930 12:9467814-9467836 CATCTCTGTGGAGAGCAGACTGG - Intergenic
1092728476 12:11507130-11507152 TATCTCTGTGGAGAGGAGGCTGG + Intergenic
1092958554 12:13573419-13573441 TCTCTCTGTGTAGCCCAGGCTGG - Intronic
1094474491 12:30830941-30830963 CATCTCTGTGGGGAACAGGCTGG + Intergenic
1094491575 12:30964026-30964048 CATCCCTGCAGAGCACAGGGCGG - Intronic
1094505056 12:31054552-31054574 CATCTCTGTGGAGAGCAGACTGG + Intergenic
1095977847 12:47951994-47952016 CATCACTGTGGAGAAGGGGCAGG + Intergenic
1096019995 12:48316137-48316159 CAGCTATGTGGAACAAAGGCAGG + Intergenic
1096045868 12:48561684-48561706 CTTCTCTCTGAATCACAGGCAGG - Intergenic
1096328718 12:50689704-50689726 GATCTCTCTGGAGGAGAGGCTGG + Intronic
1096616590 12:52836535-52836557 CCTCTCTGTGGAGGGCAGGAGGG - Intergenic
1097739187 12:63218814-63218836 CTTCTCTCTGGAGCAAAGGCTGG - Intergenic
1099631017 12:85145716-85145738 ACTTTCTGTGGAGCACAGGATGG - Intronic
1100586861 12:95988594-95988616 CATCTGTGTTGTGCTCAGGCTGG + Intronic
1100976129 12:100124406-100124428 GATCTCTGTGTTGCCCAGGCTGG - Intronic
1101325974 12:103716317-103716339 CATCTGTCTGGAGAGCAGGCTGG + Intronic
1101856760 12:108450222-108450244 CATCTCTCTGTCGCCCAGGCTGG + Intergenic
1102052348 12:109871921-109871943 CATCCCTGTGCAGCAGAGGAGGG + Intronic
1102431677 12:112889006-112889028 CTTCCCTGTGGAGAGCAGGCAGG - Intronic
1102653178 12:114457892-114457914 TAGCTCTGTGGAGCAAAGACTGG - Intergenic
1103453937 12:121050049-121050071 GATCTCTGTGTTGCCCAGGCTGG + Intergenic
1104574939 12:129958190-129958212 CTTCGCTGTGTAGCCCAGGCTGG + Intergenic
1104730990 12:131105218-131105240 CATCTCTCTTGGGCACAGTCGGG - Intronic
1105340279 13:19517004-19517026 CACATCTGTGGAGCACAAGGTGG - Intronic
1106340834 13:28825010-28825032 CATTTGTGGGGAGCACAGGGAGG + Intronic
1107751553 13:43572681-43572703 CATCTCTGGAGAGCACCCGCTGG - Intronic
1107857694 13:44631883-44631905 AATCTCTGTGTTGCCCAGGCTGG + Intergenic
1112327169 13:98449588-98449610 CCTCTCTGTGGAGCTCTGACTGG + Exonic
1113127821 13:106999945-106999967 CATCTCTGTGGATGCCACGCTGG + Intergenic
1113465754 13:110511921-110511943 CCTCTCTGTGCAGCACACGGCGG + Exonic
1113886632 13:113664238-113664260 CATCTGTGAGCAGCACAGGAGGG + Intergenic
1114627813 14:24140940-24140962 GATGTGTGGGGAGCACAGGCCGG - Exonic
1117975045 14:61288992-61289014 CTTCTCTCTGCAGCTCAGGCAGG + Intronic
1117995971 14:61478670-61478692 TATCTTTGTGTTGCACAGGCTGG - Intronic
1122459136 14:101880763-101880785 CATCTCTCTGCTGCCCAGGCTGG - Intronic
1123689659 15:22827383-22827405 CATCTCTGTGGAGAAGGTGCTGG + Exonic
1124453945 15:29822958-29822980 CATCTCCGAGGAGCTCCGGCAGG + Intronic
1126525805 15:49652747-49652769 GATCTATGTGGAGCAAAGGGTGG + Exonic
1127098312 15:55535539-55535561 GTTCTCTGTGCACCACAGGCAGG - Intergenic
1127346859 15:58109720-58109742 CAACAGTGTGGAGGACAGGCTGG + Intronic
1128159729 15:65415655-65415677 CATCTCTGTGGAAGACAGTCTGG + Intronic
1128249839 15:66156358-66156380 CCTCTCTGTGGAGGCCATGCTGG - Intronic
1128725197 15:69982836-69982858 CAACTCTGAGGAGCAGAGGCAGG + Intergenic
1128793826 15:70450742-70450764 CATCTCTGGGTAGAGCAGGCAGG - Intergenic
1129824464 15:78625491-78625513 CAACGCTGTGGGGGACAGGCAGG - Intronic
1129874525 15:78964627-78964649 CAACTCTGTGGTTCTCAGGCTGG + Intronic
1130236028 15:82134298-82134320 CCTTTCTGTAGAGCACAAGCTGG - Intronic
1130286110 15:82555968-82555990 CATCTCTTTGAAGCACTGGTTGG + Exonic
1130694605 15:86118253-86118275 CTTCTCTCTGGAGTAAAGGCTGG + Intergenic
1131053671 15:89363385-89363407 CAGCTCAGTGGAGCCTAGGCTGG - Intergenic
1131123496 15:89838267-89838289 CCCTTCAGTGGAGCACAGGCTGG - Intronic
1131694087 15:94856458-94856480 CTTCTCTGTGGCGGCCAGGCGGG - Intergenic
1133450987 16:5903879-5903901 CAGCTCTGGTGAGCACATGCAGG - Intergenic
1133536148 16:6704263-6704285 TATCTCTGTGGAGCAGGGACTGG - Intronic
1133961477 16:10497360-10497382 CATATCTGCACAGCACAGGCAGG - Intergenic
1134458072 16:14409010-14409032 CAGCTCTGGGGAGCAATGGCAGG + Intergenic
1136455713 16:30378670-30378692 GATCTCTGTGGCGCTCTGGCGGG + Exonic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1137052015 16:35722439-35722461 CATCTCTGTGGAGCACAGGCTGG - Intergenic
1137611154 16:49818554-49818576 TATCTCTGTGTTGCCCAGGCTGG - Intronic
1138438724 16:57021564-57021586 CATCACTGTGTTGCCCAGGCTGG + Intronic
1139590686 16:67931273-67931295 CCTCTCTGGGGTGCACAGCCTGG - Intronic
1140817857 16:78637499-78637521 CATCACTGTGGACCATTGGCTGG - Intronic
1141813002 16:86388745-86388767 GGTCTCAGTGGAGCACTGGCTGG - Intergenic
1142257992 16:89024517-89024539 CACCCCTGCAGAGCACAGGCTGG - Intergenic
1142279096 16:89138386-89138408 CATCTCTGTGGGGCAAGGGAAGG + Intronic
1142903113 17:3025838-3025860 CATCTCTGGGGGGCTCAGGTGGG + Intronic
1142952950 17:3498540-3498562 GATCTCTGTGTTGCCCAGGCTGG + Intronic
1143049760 17:4115220-4115242 CATCCCTGTGTTGCCCAGGCTGG + Intronic
1143524701 17:7465432-7465454 CCTCTCTCTGTAGCCCAGGCTGG - Intronic
1143731042 17:8882942-8882964 CAGCTCTGTGGAGGACAGATAGG - Intronic
1143933413 17:10456037-10456059 CATATAAGTGGAGCACAGGTAGG + Intronic
1144621445 17:16821129-16821151 CATCTCTGCAGAGGACTGGCAGG - Intergenic
1145791455 17:27630234-27630256 CATCTAGGTGGAGCACAGGAAGG + Exonic
1146055657 17:29579548-29579570 TATCTCTGTGTTGCCCAGGCTGG - Intronic
1148400849 17:47359302-47359324 TATCTCTCTGTAGCCCAGGCTGG - Intronic
1150729187 17:67677176-67677198 GAGCTCTGAGGAGCACAAGCTGG - Intronic
1151916679 17:77123439-77123461 CATCACTGTGTTGCCCAGGCTGG + Intronic
1152055378 17:78021311-78021333 CGTCTCTGAGGGGCACAGGAGGG + Intronic
1152535614 17:80948952-80948974 TCTCTCTGTGGAGCACAGAGAGG + Intronic
1152579135 17:81158323-81158345 AATCTCTGTGGCCCAGAGGCAGG - Intronic
1153943078 18:9993809-9993831 CAGCTCTGTGGAGCACAACGGGG - Intergenic
1155490181 18:26393304-26393326 CATTGCTGTGTTGCACAGGCTGG + Intergenic
1155948689 18:31884881-31884903 CCTCACTGTGTAGCCCAGGCTGG + Intronic
1156858578 18:41811579-41811601 TATCTATGTGGAGCAGAGGCTGG + Intergenic
1157508200 18:48246848-48246870 CAGCTCTCTGGACCACAGTCAGG + Intronic
1157884115 18:51349845-51349867 CAGCTATGTGTAGCACTGGCAGG + Intergenic
1159632022 18:70760020-70760042 CATGTCTGTGCATCACAGGAGGG + Intergenic
1160401086 18:78612022-78612044 CGGTTCTGGGGAGCACAGGCCGG - Intergenic
1161333357 19:3698703-3698725 CATCTCGGTGAAGAACAAGCAGG + Intronic
1162577797 19:11508982-11509004 CACCTCTGTGGAGGACAGGGTGG + Intronic
1163176116 19:15564989-15565011 CATCTCTGTGGGCCTCAGGCTGG + Intergenic
1164857428 19:31535900-31535922 CATCCCTGTGGAGCACAGACTGG - Intergenic
1164990470 19:32678942-32678964 GCTCTCTCTGGACCACAGGCAGG - Intergenic
1165485458 19:36092824-36092846 CATCCCTCTGGTGGACAGGCAGG - Intronic
1165509662 19:36258658-36258680 CATCTCTGTGGCTCAAACGCTGG + Intergenic
1165511184 19:36267621-36267643 CATCTCTGTGGGTCAGACGCTGG + Intergenic
1165827462 19:38713490-38713512 CATCTCTGAGGAGCACCGCCTGG + Intronic
1167158784 19:47754824-47754846 CTTCTCTGTGGTGGCCAGGCGGG - Exonic
1167529603 19:50007088-50007110 GGTCTCTGTGGAGAGCAGGCAGG - Intronic
1168207441 19:54861617-54861639 TATCCCTGTGTAGCCCAGGCTGG - Intronic
1168469774 19:56630559-56630581 CTTCTGTGTGGAGAACAGGCTGG + Intergenic
1168540721 19:57207571-57207593 TCTCTCTGTGTAGCCCAGGCTGG + Intronic
1202675845 1_KI270711v1_random:5899-5921 CATAACTGTGCAGCACATGCCGG - Intergenic
1202708934 1_KI270714v1_random:5902-5924 CTTCTCTTTGGAGCAGAGTCTGG + Intergenic
925596545 2:5561188-5561210 CCACTCTGTGGAGCACTGGTGGG - Intergenic
927001682 2:18801732-18801754 CATCTGTGAGGAGCAAATGCAGG - Intergenic
927583242 2:24274372-24274394 CCTCTCTGTGTTGCTCAGGCCGG - Intronic
927637545 2:24827218-24827240 ATTCTCTGTGGGTCACAGGCAGG - Intronic
927695208 2:25235212-25235234 AATCTCTCTGTTGCACAGGCTGG + Intronic
929555664 2:42924222-42924244 CCTCCCTGTGGAGAACAGGAAGG - Intergenic
929863118 2:45696149-45696171 TCTCTCTGTGTTGCACAGGCTGG + Intronic
930015966 2:46970698-46970720 CATGTCTGGGGAGCAGGGGCTGG + Intronic
930144379 2:47986312-47986334 CATCTCTGTGGAAAACAGTTTGG - Intergenic
931215114 2:60234752-60234774 CATCTCAGCTGAGCAAAGGCTGG - Intergenic
932429770 2:71667360-71667382 CTTCTCTCTGGGGCAGAGGCTGG + Exonic
933666145 2:84966740-84966762 CCTCTCTCTGTCGCACAGGCAGG - Intergenic
936064852 2:109323117-109323139 CCTCTCTCTGGAGCATATGCTGG - Intronic
936430508 2:112458490-112458512 CATCTCTGTTGCTGACAGGCTGG - Intergenic
937415830 2:121713803-121713825 TCTCTCTGTGTAGCCCAGGCTGG + Intergenic
938182573 2:129196394-129196416 CATCTCTGGGGAGCACAGAATGG - Intergenic
938377095 2:130815173-130815195 CTTCTCTGTGAAGCACGGACCGG - Intergenic
939495336 2:142921508-142921530 CATCTCTTTGTTGCTCAGGCTGG - Intronic
940151364 2:150605620-150605642 CCTCTCTGTGTCGCCCAGGCTGG - Intergenic
944694045 2:202185116-202185138 CATCTCTGTGGATCTCAGATTGG - Intronic
945726955 2:213482165-213482187 AATCACTGAGGACCACAGGCTGG + Intronic
946025863 2:216671325-216671347 CAGCTCTGTGAAACACAGGAGGG + Intergenic
946153374 2:217791021-217791043 CATCTCTGAGGACAACAGACTGG - Intergenic
947870980 2:233437841-233437863 CATCTCTGCCTAGCACATGCTGG + Intronic
948287189 2:236795080-236795102 CATCTCTCTGGAGCCCAGTGAGG + Intergenic
948360002 2:237413184-237413206 CACCTCTGTGCAGCATGGGCTGG + Intronic
1169173333 20:3485090-3485112 CATCTCTTTGTACCAGAGGCTGG + Intronic
1169644134 20:7790446-7790468 CATCTCTGGAGAGCACAGAATGG - Intergenic
1169846622 20:10000056-10000078 CATCCCTGGGGAGCCCAGCCTGG + Intronic
1170322536 20:15116233-15116255 CATCTCAGAGGTGAACAGGCAGG - Intronic
1172549759 20:35789790-35789812 CCACTTTGTGGGGCACAGGCAGG - Intronic
1172763424 20:37337558-37337580 CAGCTCAGTGGGGCACAGGGAGG + Intergenic
1173292544 20:41727274-41727296 CAGCTGTGTGGAACACAGCCTGG - Intergenic
1173854837 20:46243460-46243482 CTTCTCAGTGGAGCCCAGGACGG - Intronic
1174589421 20:51633548-51633570 TCTCTCTGTGTTGCACAGGCTGG - Intronic
1175065582 20:56284160-56284182 CATCTCACTGTAGCCCAGGCTGG - Intergenic
1175073073 20:56350892-56350914 CATATGTGTGCAGGACAGGCAGG - Intergenic
1175803098 20:61812282-61812304 CAGAGCTGAGGAGCACAGGCTGG + Intronic
1177150019 21:17445919-17445941 TCTCTCTGTGGTGCTCAGGCTGG + Intronic
1177273378 21:18876762-18876784 GACCTATGTGGAGCACAGTCTGG + Intergenic
1177541667 21:22500937-22500959 CATCTCTGGGTAGCTAAGGCAGG - Intergenic
1179321247 21:40293204-40293226 CATCTCTCTGGATCGCTGGCCGG - Intronic
1180222327 21:46366917-46366939 CATCCGTGAGGAGCACAGGCAGG + Exonic
1181414396 22:22748865-22748887 CTTCTCTGTGGAAAACAGCCAGG - Intronic
1182477224 22:30582867-30582889 CATAGCTGTGGAACTCAGGCTGG - Intronic
1182581370 22:31313980-31314002 CAACTCTGTGGAGCTCTGGGTGG + Intergenic
1185229694 22:49673036-49673058 CTTCTCTGTGGAGAAGATGCTGG - Intergenic
951548953 3:23857766-23857788 CATTCCTGAGGAGCACACGCTGG - Intronic
952386058 3:32842615-32842637 CTTCTCTGTGAGGCACATGCTGG - Intronic
952737391 3:36704291-36704313 CATCACTCTGGAGCACAGCCCGG - Intergenic
953385950 3:42505700-42505722 CATCCTTGGGGAGCCCAGGCTGG + Intronic
955459706 3:59168370-59168392 CATGTCAGTGGTACACAGGCTGG - Intergenic
956780724 3:72601087-72601109 CCTCTCTGTGGAGCCAAGGAGGG - Intergenic
956939377 3:74139114-74139136 CATCTCTTTTGAGCATAGCCCGG + Intergenic
958838293 3:99172028-99172050 CACCTGTGTGGAGAACAGTCTGG - Intergenic
960418579 3:117415369-117415391 GATTTCTGTGGAGCACACTCTGG - Intergenic
960632316 3:119744494-119744516 TTGCTGTGTGGAGCACAGGCTGG + Intronic
961049089 3:123731677-123731699 CATGTTTGGGGAGCACTGGCAGG - Intronic
963719478 3:148844543-148844565 CATCAATATTGAGCACAGGCAGG - Exonic
964159619 3:153631100-153631122 CATCTCTGTGAAGGAAGGGCAGG - Intergenic
966732050 3:183159474-183159496 GAGCTCTGAGGAGCACAGTCAGG + Intronic
967082081 3:186058981-186059003 CCTCTCTCTGTTGCACAGGCAGG - Intronic
968360552 3:198144060-198144082 CACCTCTTTGGAGCACTAGCTGG + Intergenic
968447150 4:657763-657785 CATGGCTGTGCAGCAGAGGCAGG + Intronic
968447193 4:657901-657923 CATGGCTGTGTGGCACAGGCAGG + Intronic
968447207 4:657957-657979 CATGGCTGTGCAGCAGAGGCAGG + Intronic
969599141 4:8165615-8165637 CAGCTCTGGGAAGCACAGCCTGG - Intergenic
971422698 4:26488682-26488704 CAGCTTTGGGGAGAACAGGCTGG + Intronic
971860258 4:32092669-32092691 CATCACTGTGTTGCCCAGGCTGG + Intergenic
973130494 4:46642130-46642152 CCTCTCTCTGGTGCCCAGGCTGG - Intergenic
973893626 4:55391659-55391681 CATCTCTCTGTCGCCCAGGCAGG + Intergenic
974603709 4:64122398-64122420 CTTCTCTGTGTACCACAAGCAGG + Intergenic
977958631 4:103059035-103059057 TATCGCTGTGTAACACAGGCTGG - Intronic
978512372 4:109534871-109534893 TATCCCTGTGTAGCCCAGGCTGG + Intronic
980241609 4:130184748-130184770 TCTCTCTGTGTAGCCCAGGCTGG + Intergenic
980257604 4:130402566-130402588 GCTCTCTGTGCACCACAGGCAGG + Intergenic
982637841 4:157919556-157919578 TCTCTCTGTGTAGCCCAGGCTGG + Intergenic
982982630 4:162159641-162159663 CACCTCTGTAGAACACAGCCTGG - Intronic
983266869 4:165516442-165516464 CAGATCTGTGGAGCAAAGGTAGG - Intergenic
984262444 4:177458166-177458188 CAACTTTGTGGAGCACAGAAAGG + Intergenic
985620272 5:951358-951380 AATCATTGTGGAGCACAGCCAGG - Intergenic
985786554 5:1898334-1898356 CATCTCTGTGGGGCACGGGGAGG + Intergenic
986146065 5:5079042-5079064 CATGGCTGTGGAGGACACGCTGG - Intergenic
986180673 5:5390444-5390466 CATCTCAGAGCAGCACAGGGAGG + Intergenic
987153068 5:15060757-15060779 CATCTGTCTTCAGCACAGGCTGG - Intergenic
987250520 5:16095863-16095885 CAGCTCTGTGGTGCACAGGAGGG - Intronic
992614250 5:78534258-78534280 CCTCTCTGTGGAGCACACTGCGG - Intronic
993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG + Intergenic
995486371 5:112644168-112644190 CATCTTTTGGCAGCACAGGCAGG - Intergenic
995532649 5:113106595-113106617 CAATCCTGTGGAGTACAGGCAGG + Intronic
997219906 5:132153048-132153070 CCTCTCTCTGTAGCCCAGGCTGG + Intergenic
997248051 5:132368355-132368377 CATCCCTGTGTTGCCCAGGCTGG - Intergenic
998080475 5:139271113-139271135 CATCTCTATGTTGCCCAGGCTGG + Intronic
998116933 5:139545261-139545283 GATCTCTATGTTGCACAGGCCGG + Intronic
998823907 5:146082032-146082054 CACCTCTGTGGAGCAAACTCTGG + Intergenic
998943649 5:147313203-147313225 TCTCTCTCTGTAGCACAGGCTGG - Intronic
999027253 5:148248307-148248329 TCTCGCTGTGTAGCACAGGCTGG + Intergenic
999433275 5:151542303-151542325 CATTTCTGAGCAGAACAGGCAGG - Exonic
1000233904 5:159340169-159340191 TCTCTCTGTGTAGCCCAGGCTGG + Intergenic
1000393578 5:160749787-160749809 CATGTGTGTGGATCACAGGAGGG + Intronic
1000909515 5:167005300-167005322 CATCTATGTGGTACACAGGTGGG - Intergenic
1001764208 5:174232557-174232579 CATCTGTGTGGAGCTCAGCGAGG + Intronic
1002445283 5:179286713-179286735 CATCACAGGGCAGCACAGGCCGG + Intronic
1003381083 6:5625249-5625271 CATTTCTGAGCAGCACAGACAGG + Intronic
1004528398 6:16430399-16430421 CAGCTTTGTGTACCACAGGCTGG - Intronic
1005272000 6:24176095-24176117 CCTCCCTGTGTTGCACAGGCTGG - Intronic
1006337231 6:33427079-33427101 CATCTCTGTGAGGCAAAGTCAGG + Intronic
1006407719 6:33855029-33855051 AAGGTCTGGGGAGCACAGGCAGG + Intergenic
1006422163 6:33941793-33941815 CATCCCTGTAGGGCACAGGTAGG + Intergenic
1012457976 6:99428144-99428166 TCTCGCTGTGTAGCACAGGCTGG - Intergenic
1013300417 6:108799926-108799948 CATCTCTGTTGAGCACAGCCAGG + Intergenic
1014804712 6:125816145-125816167 CATCTCTAATGAGCACAGCCTGG - Intronic
1016061392 6:139634897-139634919 ACTCTCTGTGTTGCACAGGCTGG + Intergenic
1017087525 6:150728025-150728047 CATCTCTGTGTAGCAGATACTGG - Intronic
1017695976 6:157016682-157016704 CATCCCTGCAGAGCACAGGCGGG - Intronic
1018230828 6:161673616-161673638 CATCTGTTTGGAGACCAGGCTGG + Intronic
1019027837 6:168986124-168986146 CAGCTCTGAGGAGCACTGGCTGG - Intergenic
1019219848 6:170464640-170464662 CAGCCCTGTGAAGCACAGACCGG - Intergenic
1019259452 7:72572-72594 CACCTCTTTGGAGCACTAGCTGG - Intergenic
1019366109 7:633880-633902 AATCCCTGAGGAGCCCAGGCAGG - Intronic
1019455853 7:1127148-1127170 GGTCTCTGTGGAGCAGAGCCTGG - Intronic
1019707205 7:2502396-2502418 CAGCTGTGGGGAGGACAGGCTGG - Intergenic
1019777888 7:2923293-2923315 CACCTCTGTGGGGCACGTGCGGG - Exonic
1019897284 7:3992226-3992248 GAGCTCTGTGGAGCAGAGCCTGG + Intronic
1019902057 7:4028663-4028685 TAGCTCTCTGGAGGACAGGCTGG + Intronic
1021498147 7:21298888-21298910 CAACTCTGTAGAGCAGAGGCTGG - Intergenic
1023079359 7:36513213-36513235 CACCCCTGGGGAGCACAGGGAGG - Exonic
1023751798 7:43379912-43379934 CAGCTCTGAAGAGGACAGGCAGG - Intronic
1023965860 7:44962804-44962826 CATCTCCGTGGAGCCCAGGCCGG - Exonic
1025767314 7:64467729-64467751 CATGGCTGGGGTGCACAGGCTGG - Intergenic
1025810995 7:64875389-64875411 CAGCCCTGGGGAACACAGGCAGG - Intronic
1026279327 7:68907886-68907908 TATCTCTGTGTTGCCCAGGCTGG + Intergenic
1026852388 7:73733170-73733192 TCTCTCTGTGGTGCCCAGGCTGG - Intergenic
1027573427 7:79901309-79901331 AATATCTGTGGAGCACAGAAAGG - Intergenic
1028599950 7:92590446-92590468 TATCTCTGTGGAGGACAGGCCGG + Intergenic
1029364160 7:100106638-100106660 CATCTGTGAGGGGCAGAGGCAGG - Exonic
1029415002 7:100436872-100436894 CCTCTCTCTGTAGCCCAGGCTGG + Intergenic
1030604321 7:111623117-111623139 CCTCTCTGTGTTGCCCAGGCTGG + Intergenic
1032443187 7:131958075-131958097 CTTCTCTGTGGACCTCAGGCTGG - Intergenic
1033434992 7:141325239-141325261 CATCTTTGTGAAGCAGATGCAGG + Intronic
1033733417 7:144199652-144199674 CATCTCTGTTGAAGCCAGGCTGG + Intergenic
1033749635 7:144351321-144351343 CATCTCTGTTGAAGCCAGGCTGG - Intergenic
1033851549 7:145502293-145502315 CAACACTCTAGAGCACAGGCAGG + Intergenic
1034391411 7:150790512-150790534 CCTCTATGTAAAGCACAGGCTGG + Intergenic
1035204955 7:157289301-157289323 CATCTCAGAGAAGCACTGGCTGG + Intergenic
1035315803 7:157997156-157997178 CAGCTCTGTGCAGAACTGGCAGG - Intronic
1035369972 7:158373265-158373287 CATCTTTGTGCAGAATAGGCCGG - Intronic
1035383626 7:158456271-158456293 CTTCTCTGTGGAGCAATGGGGGG - Intronic
1035394584 7:158526747-158526769 CAACCCTGTGGGGCACAGGGAGG + Intronic
1036947271 8:13106027-13106049 CATTCCTGTGGAGCCCAGCCTGG - Intronic
1038561585 8:28585798-28585820 CAGCTATGTGGCGCCCAGGCTGG + Intergenic
1038783533 8:30589722-30589744 CAAATCTGTGCAGCAGAGGCTGG + Intronic
1039320414 8:36424084-36424106 TCTCTCTCTTGAGCACAGGCTGG - Intergenic
1039542653 8:38383898-38383920 CCTCTCTGTGTCGCCCAGGCTGG - Intergenic
1040529521 8:48255067-48255089 GACCTCAGTGGAGCACAGCCTGG - Intergenic
1043432858 8:80211409-80211431 AATCACTGTGGAGCACATACTGG + Intronic
1043562505 8:81510502-81510524 CATCTCTACGGAACAAAGGCAGG - Intergenic
1043564242 8:81530449-81530471 CAGCTCTGTGCAGCACATGTAGG + Intronic
1043676156 8:82957019-82957041 AGTCTCTGTGGAAAACAGGCTGG + Intergenic
1044831054 8:96249669-96249691 CATCAGTGTGGAGAACAGTCTGG + Intronic
1046766270 8:118073588-118073610 CCTCTCTCTGTAGCCCAGGCTGG - Intronic
1047168590 8:122467170-122467192 CCTCTCTGTGCACCACAGGCAGG - Intergenic
1047401593 8:124553195-124553217 TATCCCTGAGGAGCACAGACAGG - Exonic
1048215056 8:132486535-132486557 CAACTCTGTGGAGGAGAGGTTGG + Intergenic
1048484984 8:134838990-134839012 AATCTCTCTGTAGCACAGGCTGG - Intergenic
1048631148 8:136243787-136243809 CATCTCTCTGTCACACAGGCTGG - Intergenic
1048847756 8:138616274-138616296 CCTCTCTGTGCAGCTCAAGCAGG + Intronic
1049451999 8:142666961-142666983 CCTCCCTGAGGAGCAGAGGCAGG + Intronic
1051288274 9:15518611-15518633 GGTCTCTGTGTTGCACAGGCTGG + Intergenic
1052946509 9:34172813-34172835 TCTCTCTATGGTGCACAGGCTGG - Intergenic
1053565630 9:39247702-39247724 CATCTCTCCGGAGCAGAAGCTGG + Intronic
1053831396 9:42085557-42085579 CATCTCTCCGGAGCAGAAGCTGG + Intronic
1054131519 9:61371334-61371356 CATCTCTCCGGAGCAGAAGCTGG - Intergenic
1054599151 9:67101881-67101903 CATCTCTCCGGAGCAGAAGCTGG - Intergenic
1056032232 9:82564977-82564999 GAACTCTGAGGAGGACAGGCTGG + Intergenic
1056933309 9:90896469-90896491 CCTCTCTGTGGAGGAGAGGAAGG - Exonic
1059104459 9:111499790-111499812 TCTCTCTCTGTAGCACAGGCTGG - Intergenic
1061135531 9:128731292-128731314 CACCGCTCTGGACCACAGGCGGG - Exonic
1061419464 9:130465567-130465589 CACCTGTGGGCAGCACAGGCCGG + Intronic
1061993533 9:134172927-134172949 CCTGTCTCTGCAGCACAGGCCGG - Intergenic
1062683492 9:137797878-137797900 CCTGTGTGAGGAGCACAGGCAGG + Intronic
1062745252 9:138207891-138207913 CACCTCTTTGGAGCACTAGCTGG + Intergenic
1185663933 X:1749489-1749511 CATCACTGTGTTGCTCAGGCTGG - Intergenic
1186200249 X:7148760-7148782 CATCTCTGAGCATCCCAGGCTGG + Intergenic
1186512836 X:10143296-10143318 GATCCTTGTGGGGCACAGGCTGG - Exonic
1187761824 X:22595824-22595846 CTTCTCTCTGTAGCCCAGGCTGG + Intergenic
1188440370 X:30210049-30210071 CATCTCTGGGGATCCCAGGAAGG + Intergenic
1189164418 X:38846569-38846591 CATCTGTATGGAGCAGAGGAAGG + Intergenic
1189355237 X:40305414-40305436 TCTCTCTGTGGTGCCCAGGCTGG + Intergenic
1189381207 X:40503641-40503663 CATCACTGTGTTGCCCAGGCTGG - Intergenic
1189847726 X:45151879-45151901 CATCTCTGAGAAGCAGAGCCTGG - Exonic
1190784022 X:53625975-53625997 CATCTCTATGGAGCACAGGCTGG - Intronic
1191019253 X:55842231-55842253 GATCTGTGTGGAGGACAGTCTGG + Intergenic
1192175287 X:68881235-68881257 CATTCCTATGGAGAACAGGCTGG + Intergenic
1192693525 X:73390797-73390819 CACTTCAGTGGAGCACAGCCAGG + Intergenic
1192872274 X:75195467-75195489 CATCTATGAGGAGCACTGCCAGG - Intergenic
1196111996 X:111956183-111956205 CATCTGTGAGGAGGAAAGGCTGG + Intronic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1199880538 X:151971028-151971050 CATGGCTGTGGAGCTCAGGGTGG - Intronic
1200174706 X:154105538-154105560 CTTCTCTGTGTAGGACAGGGAGG - Intergenic
1200707551 Y:6455881-6455903 CAACTCTGGGCAACACAGGCGGG + Intergenic
1200918968 Y:8596140-8596162 CAGCCCTGGGGAACACAGGCAGG - Intergenic
1201026561 Y:9708827-9708849 CAACTCTGGGCAACACAGGCGGG - Intergenic
1202175921 Y:22098855-22098877 CAACCCTGAGGAACACAGGCAGG + Intergenic
1202181620 Y:22144774-22144796 CAACTCTGGGGAACACAAGCGGG + Intergenic
1202209740 Y:22441628-22441650 CAACTCTGGGGAACACAAGCGGG - Intergenic
1202215440 Y:22487529-22487551 CAACCCTGAGGAACACAGGCAGG - Intergenic