ID: 1137065362

View in Genome Browser
Species Human (GRCh38)
Location 16:35835628-35835650
Sequence CTCAGCAATGATGAGCAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137065362_1137065363 27 Left 1137065362 16:35835628-35835650 CCTCATTGCTCATCATTGCTGAG No data
Right 1137065363 16:35835678-35835700 TGATATTATGTAGTATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137065362 Original CRISPR CTCAGCAATGATGAGCAATG AGG (reversed) Intergenic
No off target data available for this crispr