ID: 1137081421

View in Genome Browser
Species Human (GRCh38)
Location 16:36063075-36063097
Sequence CCAAATATCCACATGCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137081421_1137081424 -4 Left 1137081421 16:36063075-36063097 CCTTTGTGCATGTGGATATTTGG No data
Right 1137081424 16:36063094-36063116 TTGGAGCCCTTTGTGGCCTATGG No data
1137081421_1137081425 -1 Left 1137081421 16:36063075-36063097 CCTTTGTGCATGTGGATATTTGG No data
Right 1137081425 16:36063097-36063119 GAGCCCTTTGTGGCCTATGGTGG No data
1137081421_1137081428 5 Left 1137081421 16:36063075-36063097 CCTTTGTGCATGTGGATATTTGG No data
Right 1137081428 16:36063103-36063125 TTTGTGGCCTATGGTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137081421 Original CRISPR CCAAATATCCACATGCACAA AGG (reversed) Intergenic
No off target data available for this crispr