ID: 1137081866

View in Genome Browser
Species Human (GRCh38)
Location 16:36071905-36071927
Sequence ACATAAAGACTACACAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137081862_1137081866 13 Left 1137081862 16:36071869-36071891 CCTTTTGAGGCCTATTGTGGAAA No data
Right 1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG No data
1137081864_1137081866 3 Left 1137081864 16:36071879-36071901 CCTATTGTGGAAAAAGGATTATT No data
Right 1137081866 16:36071905-36071927 ACATAAAGACTACACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137081866 Original CRISPR ACATAAAGACTACACAGAGA GGG Intergenic
No off target data available for this crispr