ID: 1137083546

View in Genome Browser
Species Human (GRCh38)
Location 16:36095781-36095803
Sequence CAAAATAAAGAGATGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137083546_1137083550 7 Left 1137083546 16:36095781-36095803 CCTCCCTCCATCTCTTTATTTTG No data
Right 1137083550 16:36095811-36095833 GTGTGTCTCTGCACATGAGATGG 0: 1141
1: 3759
2: 3187
3: 1959
4: 1399
1137083546_1137083551 8 Left 1137083546 16:36095781-36095803 CCTCCCTCCATCTCTTTATTTTG No data
Right 1137083551 16:36095812-36095834 TGTGTCTCTGCACATGAGATGGG 0: 1229
1: 3886
2: 3168
3: 1892
4: 1280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137083546 Original CRISPR CAAAATAAAGAGATGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr