ID: 1137084296

View in Genome Browser
Species Human (GRCh38)
Location 16:36101635-36101657
Sequence CGGCAAAAAGCCGCGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137084286_1137084296 21 Left 1137084286 16:36101591-36101613 CCGCATTGGTAAAAACCTGTGGC No data
Right 1137084296 16:36101635-36101657 CGGCAAAAAGCCGCGGTGGCGGG No data
1137084290_1137084296 6 Left 1137084290 16:36101606-36101628 CCTGTGGCGGCGGGAGTAAAAAG No data
Right 1137084296 16:36101635-36101657 CGGCAAAAAGCCGCGGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137084296 Original CRISPR CGGCAAAAAGCCGCGGTGGC GGG Intergenic
No off target data available for this crispr