ID: 1137241969

View in Genome Browser
Species Human (GRCh38)
Location 16:46663463-46663485
Sequence CACTTGAATCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137241969_1137241975 9 Left 1137241969 16:46663463-46663485 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1137241975 16:46663495-46663517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1137241969_1137241973 8 Left 1137241969 16:46663463-46663485 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1137241973 16:46663494-46663516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1137241969_1137241977 17 Left 1137241969 16:46663463-46663485 CCTCCGTCTCCTGGATTCAAGTG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
Right 1137241977 16:46663503-46663525 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137241969 Original CRISPR CACTTGAATCCAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr