ID: 1137244014

View in Genome Browser
Species Human (GRCh38)
Location 16:46688583-46688605
Sequence GTGTTTGTCAGCGAGTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137244014_1137244020 0 Left 1137244014 16:46688583-46688605 CCCCAGAACTCGCTGACAAACAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1137244020 16:46688606-46688628 TGCAGCCGAAGGCGGGTATGAGG 0: 1
1: 0
2: 0
3: 4
4: 66
1137244014_1137244022 10 Left 1137244014 16:46688583-46688605 CCCCAGAACTCGCTGACAAACAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1137244022 16:46688616-46688638 GGCGGGTATGAGGCCAAGAAAGG 0: 1
1: 0
2: 0
3: 13
4: 122
1137244014_1137244018 -8 Left 1137244014 16:46688583-46688605 CCCCAGAACTCGCTGACAAACAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1137244018 16:46688598-46688620 ACAAACACTGCAGCCGAAGGCGG 0: 1
1: 0
2: 1
3: 18
4: 135
1137244014_1137244023 16 Left 1137244014 16:46688583-46688605 CCCCAGAACTCGCTGACAAACAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1137244023 16:46688622-46688644 TATGAGGCCAAGAAAGGCCAAGG 0: 1
1: 1
2: 1
3: 32
4: 347
1137244014_1137244019 -7 Left 1137244014 16:46688583-46688605 CCCCAGAACTCGCTGACAAACAC 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1137244019 16:46688599-46688621 CAAACACTGCAGCCGAAGGCGGG 0: 1
1: 0
2: 1
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137244014 Original CRISPR GTGTTTGTCAGCGAGTTCTG GGG (reversed) Intronic
901112203 1:6807217-6807239 GAGTTTGTTAGTGAGTTGTGTGG + Intronic
901258483 1:7853708-7853730 ATGTTTATCAGCGAGTTTTCTGG - Intergenic
901737054 1:11319390-11319412 GTGGATGTCAGCTATTTCTGCGG - Intergenic
909784601 1:79595158-79595180 GTGTTTGTCAACAAATGCTGGGG - Intergenic
912002861 1:104856598-104856620 GTTTTTGCCAGTGAGTTTTGGGG + Intergenic
912334792 1:108852149-108852171 GAGTTGGTCAGTGAGTTCTGGGG + Exonic
912627299 1:111216195-111216217 TTGTTTATCAGCTTGTTCTGGGG + Intronic
915830112 1:159120509-159120531 GTTTTTGACAGCCAGCTCTGTGG - Intronic
917755889 1:178097428-178097450 ATGATTGTCAGGGAATTCTGGGG + Intronic
919429541 1:197475432-197475454 ATGTTTGACAGGGATTTCTGAGG - Intronic
1064799009 10:19047378-19047400 GTGTGTGTCTGCGTGTTCTCAGG + Intergenic
1067057101 10:43058678-43058700 GTGTTGGTTAGCCAGTGCTGAGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1068251754 10:54452084-54452106 GTTTTTGCCACCCAGTTCTGAGG + Intronic
1072108035 10:92291861-92291883 GTGTTTGTCAGCGATGTCACTGG + Intronic
1076128597 10:127995240-127995262 GTGTCTCCCAGTGAGTTCTGAGG + Intronic
1076160897 10:128243405-128243427 GGGCTTGTCAGTGAGTCCTGGGG - Intergenic
1079969106 11:27014807-27014829 GTGGTGTTCAGTGAGTTCTGTGG - Intergenic
1083933104 11:65856854-65856876 ATTTTTATCAGCGACTTCTGGGG - Intronic
1084863295 11:72036615-72036637 GTGTTTGTGAGACATTTCTGTGG - Intronic
1087048157 11:93861771-93861793 GTGTTTGTTGGCGTGTTCTCTGG - Intergenic
1089816975 11:121184498-121184520 GTGGTGGTCAGAGAGTGCTGTGG + Intronic
1093267344 12:17018938-17018960 GTTTTTGTAAACGAGTTCTGTGG + Intergenic
1096572201 12:52530031-52530053 GTGGTGCTCAGCGAGGTCTGTGG - Intergenic
1097772587 12:63605429-63605451 GTGTTTTTCTGTGCGTTCTGAGG + Intronic
1100231723 12:92615443-92615465 GTTTTTATCAGCTAGTGCTGGGG - Intergenic
1101867492 12:108531631-108531653 GTCTTTGCAAGCCAGTTCTGAGG + Intronic
1102202669 12:111068416-111068438 ACGCTTGTCAGCGAGTGCTGCGG + Intronic
1102821326 12:115911421-115911443 GTGTTGGTAAGCTAGTTCTCTGG - Intergenic
1106487567 13:30185738-30185760 GTGTTTCTCCTCCAGTTCTGAGG + Intergenic
1106974089 13:35185480-35185502 GTGTTTGTCAGCCAGCAGTGAGG - Intronic
1108625452 13:52224244-52224266 GTGTTTGTCAGTGGGATCTTTGG + Intergenic
1108660608 13:52582166-52582188 GTGTTTGTCAGTGGGATCTTTGG - Intergenic
1108930234 13:55808388-55808410 GTGATAGTCAGGGAGTTCTCAGG - Intergenic
1110056225 13:70976108-70976130 GTTTTTGGCAGGGAGTTCTGAGG + Intergenic
1117287387 14:54299951-54299973 GTCTTTATCAGCAAATTCTGTGG + Intergenic
1117457780 14:55914969-55914991 GTGTTTGTCAGCCTGCTTTGTGG - Intergenic
1117562767 14:56959518-56959540 GTGTTTGCCAGCAAGTTATTTGG - Intergenic
1119307349 14:73618319-73618341 CTGTTTGGCAGAGAATTCTGGGG - Intronic
1123782671 15:23643761-23643783 GTGTTTTTAAGTGAGATCTGTGG - Exonic
1126676072 15:51160228-51160250 GTGTCTGAGAGCGAGTGCTGGGG - Intergenic
1136025921 16:27469157-27469179 GTGTTTTTCTGTGTGTTCTGTGG + Intronic
1137244014 16:46688583-46688605 GTGTTTGTCAGCGAGTTCTGGGG - Intronic
1140270355 16:73459835-73459857 GTGATAGTCAGTGAGTTCTCAGG - Intergenic
1147744981 17:42689405-42689427 GTGTGTCTCACCGGGTTCTGGGG + Intronic
1149759958 17:59220337-59220359 GCGTTTGTCACCTAGCTCTGTGG - Intergenic
1151205289 17:72502066-72502088 GTGTTTGAAAGCGGGATCTGTGG - Intergenic
1151915112 17:77112073-77112095 GTGTTAGTGAGTGAGTTCTCAGG + Intronic
1152975004 18:206919-206941 GTTTTTTTCTGAGAGTTCTGTGG + Intronic
1157635769 18:49152719-49152741 GTATCTGTCAGCGAGTACTTAGG - Intronic
1159716408 18:71828807-71828829 GTGTTTCTCAGTGAGTGATGGGG - Intergenic
1161834352 19:6635546-6635568 GTGTTTATCATCGAATTCAGTGG + Intergenic
1162581671 19:11535192-11535214 GTGTTTGTCTGTGTGTTTTGGGG - Intergenic
1163539866 19:17901661-17901683 GTGTTTTTCAACAAATTCTGCGG - Intergenic
1167358924 19:49019665-49019687 GTGGTGGTCTGCGAGTTGTGGGG + Intergenic
927238886 2:20902500-20902522 GTGAAAGCCAGCGAGTTCTGTGG + Intergenic
932865590 2:75338160-75338182 GGGTTTGCCAGTGAGTGCTGAGG - Intergenic
933603441 2:84356552-84356574 GTGTTTTTCTTCCAGTTCTGTGG - Intergenic
934972792 2:98776340-98776362 GTGGTTCTCAGCCAGCTCTGAGG - Intergenic
937378035 2:121351223-121351245 GTGTGTGTCAGCCACATCTGAGG - Intronic
940726868 2:157344585-157344607 TTGTTGGTTAGCGAGTTTTGGGG - Intergenic
941757383 2:169202232-169202254 GACTTTCTCAGGGAGTTCTGAGG - Intronic
946069353 2:217018147-217018169 GTGGTTGTCAGGGAGATGTGAGG + Intergenic
1169324144 20:4661546-4661568 GTGTTTGTCGGCGCGCTCTCGGG + Intergenic
1171135913 20:22694239-22694261 GTGTTGTCCAGCGTGTTCTGGGG + Intergenic
1173366833 20:42393501-42393523 GTGTGTGTCAGCCACATCTGGGG + Intronic
1176743598 21:10630915-10630937 GAGTTTGTCCGGGACTTCTGAGG - Intergenic
1177327616 21:19612631-19612653 GTGTTAGTGAGTGAGTTCTCAGG + Intergenic
1177587900 21:23122580-23122602 GTGATTGTAAGTGAGTTCTCAGG + Intergenic
1185170048 22:49287672-49287694 GTGTGTGTCAGCGAGCTCTTGGG + Intergenic
950888809 3:16384952-16384974 GTTTTTGACAGTGATTTCTGAGG + Intronic
955376193 3:58399247-58399269 GGATTTGCCAGCGTGTTCTGTGG + Intronic
958920964 3:100104814-100104836 GTGATTCTCAGCCAGTTTTGGGG - Intronic
960501637 3:118445200-118445222 GTGTCTGTCAGTGTGTTCTTGGG + Intergenic
967891343 3:194366495-194366517 GTGTTTCTGAGCATGTTCTGTGG - Intronic
969237144 4:5873590-5873612 GTGATAGTGAGTGAGTTCTGAGG - Intronic
969465467 4:7353718-7353740 GTGTTTGTCAGGGAGCCCAGGGG + Intronic
970008376 4:11431369-11431391 GTGTCTGTCAGTCAGTTGTGTGG + Intergenic
970958377 4:21842006-21842028 GTGATTGTCATCAATTTCTGAGG - Intronic
975148332 4:70993865-70993887 GTCTTTCTCAGCCAGCTCTGAGG + Exonic
982991419 4:162281047-162281069 GTTTTTGTCATAGAGTTCTCAGG + Intergenic
984580781 4:181507600-181507622 GTGTGTGTCAGGGATTTGTGAGG - Intergenic
984907104 4:184638589-184638611 GTGTATGTGAGTCAGTTCTGGGG + Intronic
985683580 5:1270060-1270082 GACTTTGTCAGCGAATTCTGTGG + Intronic
990278899 5:54228953-54228975 GTGTCTGTGAGAGATTTCTGGGG + Intronic
990396021 5:55379559-55379581 GTGTGTGTCAGGGAGATTTGGGG - Intronic
995980136 5:118091761-118091783 GTGATAGTGAGTGAGTTCTGAGG + Intergenic
996614895 5:125429526-125429548 GTGCTTCTCAGTGAGTGCTGTGG - Intergenic
998136127 5:139675620-139675642 GTGTTAGTCACCCTGTTCTGTGG - Intronic
998200728 5:140116846-140116868 TTGTCTGACAGAGAGTTCTGGGG + Exonic
1002695298 5:181084618-181084640 GTGTTTCTCTCCGAATTCTGTGG - Intergenic
1003428420 6:6015459-6015481 GTGTTTGGCAGGGGCTTCTGTGG - Intergenic
1016000148 6:139033496-139033518 GTGTTTGTCAGTTCATTCTGGGG + Intronic
1018937281 6:168281988-168282010 GTGTGGGCCAGCGAGTGCTGTGG + Intergenic
1019802910 7:3101482-3101504 ATGTCTGTCAACGAGCTCTGAGG + Intergenic
1022123783 7:27335992-27336014 ATGTGTGTAAGAGAGTTCTGGGG - Intergenic
1022365639 7:29713225-29713247 GTGGTTTTCTGTGAGTTCTGAGG - Intergenic
1022695878 7:32704922-32704944 GTGTTTTTCTGTGAGTTCTGAGG + Intergenic
1022932148 7:35129118-35129140 GTGTTTTTCTGTGAGTTCTGAGG + Intergenic
1024949568 7:54845521-54845543 GTGTTTTTCAGATTGTTCTGAGG - Intergenic
1029828083 7:103221915-103221937 GTGTTTTTCTGTGAGTTCTGAGG + Intergenic
1032712183 7:134470056-134470078 TTGTTTGTCCGCGAGCTCTCGGG + Intergenic
1034402937 7:150877766-150877788 GTGTTTGACAGCCACATCTGTGG - Intergenic
1041827594 8:62114093-62114115 GTGATAGTGAGTGAGTTCTGGGG + Intergenic
1042532672 8:69832105-69832127 GTGTTCGTCAGCTACTTCGGCGG - Exonic
1044937294 8:97305393-97305415 GTGTTTCTCAGAGAATTGTGGGG - Intergenic
1048414939 8:134216953-134216975 GTTTTTGTAAACCAGTTCTGTGG - Intergenic
1050353230 9:4760125-4760147 CCTTTTGTCAGGGAGTTCTGGGG - Intergenic
1051054213 9:12964681-12964703 GTCTTTTTCAGCAATTTCTGTGG - Intergenic
1053184052 9:35999895-35999917 GTGTGTGTCTGGGAGTACTGGGG - Intergenic
1053417233 9:37954399-37954421 GTGGTTGTCAGTGAGTCTTGTGG + Intronic
1053425371 9:38006676-38006698 GCGTTTGTCAGCGAGGGCTCAGG - Intronic
1055969103 9:81894038-81894060 TTGCTTTTCAGTGAGTTCTGAGG + Intergenic
1058763003 9:108154341-108154363 TTGTATGTCAGTGAGATCTGGGG + Intergenic
1185567365 X:1105647-1105669 GTTTTTGTGAGCAGGTTCTGGGG - Intergenic
1188129572 X:26414726-26414748 GTGATTGTGAGGGAGTTCTCAGG - Intergenic
1188418342 X:29965225-29965247 GTGTTTTTCAGAGTGGTCTGTGG - Intergenic
1189362824 X:40366538-40366560 GTGGTAGTCAGGGAGTTCTCAGG - Intergenic
1190152653 X:47960739-47960761 GTCTGTGTCAGAGAGCTCTGAGG + Intronic