ID: 1137246879

View in Genome Browser
Species Human (GRCh38)
Location 16:46712866-46712888
Sequence CCATATGGCTGATGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137246879_1137246891 17 Left 1137246879 16:46712866-46712888 CCCACTTCCCATCAGCCATATGG 0: 1
1: 0
2: 3
3: 19
4: 185
Right 1137246891 16:46712906-46712928 CATTACACCTGTGAATTACTGGG 0: 1
1: 0
2: 0
3: 15
4: 188
1137246879_1137246892 18 Left 1137246879 16:46712866-46712888 CCCACTTCCCATCAGCCATATGG 0: 1
1: 0
2: 3
3: 19
4: 185
Right 1137246892 16:46712907-46712929 ATTACACCTGTGAATTACTGGGG 0: 1
1: 0
2: 1
3: 22
4: 282
1137246879_1137246890 16 Left 1137246879 16:46712866-46712888 CCCACTTCCCATCAGCCATATGG 0: 1
1: 0
2: 3
3: 19
4: 185
Right 1137246890 16:46712905-46712927 ACATTACACCTGTGAATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137246879 Original CRISPR CCATATGGCTGATGGGAAGT GGG (reversed) Intronic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
901220424 1:7580516-7580538 CCACCTGGCTCATGGGAAGAGGG - Intronic
902897314 1:19487682-19487704 TCATATAGCTGAAGGGAAGGAGG + Intergenic
904260770 1:29286456-29286478 CCACTTGGCTGATGAGCAGTAGG + Intronic
904891487 1:33782937-33782959 CCATGTGGCAGATGGGTAGATGG + Intronic
905030746 1:34882861-34882883 CCATGTGGCTGGTGTGGAGTGGG - Intronic
906732112 1:48091804-48091826 CCCAAGGGCTGAAGGGAAGTTGG - Intergenic
908429853 1:64045887-64045909 CAAGATGGCAGATGGTAAGTGGG - Intronic
909104664 1:71393198-71393220 CCCTAGGGCTCATGGGAAGTTGG + Intergenic
911048731 1:93651365-93651387 TCATCTGGCAGATGGGAAGCTGG + Intronic
914344553 1:146787539-146787561 CCATGTGGCTGTTGAGATGTCGG + Intergenic
918158212 1:181871890-181871912 CATCATGGCAGATGGGAAGTAGG + Intergenic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
919851208 1:201674216-201674238 CCCTCTGGCTGATGGGGACTTGG + Intronic
920746904 1:208637615-208637637 CCATAGGGGAGAAGGGAAGTGGG - Intergenic
921070909 1:211656876-211656898 CTATGGGGCTGATGGGAGGTGGG - Intergenic
923071046 1:230564733-230564755 CCATATGGCATATGGGAAATGGG + Intergenic
1064321152 10:14305966-14305988 CTATTTGGCGGATGGGCAGTGGG + Intronic
1065666870 10:28072462-28072484 CAAAATGGCTGATGGGTAGAGGG - Intronic
1068388263 10:56359925-56359947 CCATTTGGCTGATGGGAAGGAGG - Intronic
1068501224 10:57841516-57841538 CCCAATGGCTGTTGGGAATTTGG - Intergenic
1071355070 10:84785440-84785462 CAATATGGCTGACTAGAAGTAGG - Intergenic
1071835323 10:89412167-89412189 CCCAATTGCTGATGGGAATTTGG - Intronic
1071970364 10:90899606-90899628 CAATATGGCTGATGTGAAGTAGG - Intronic
1073123806 10:101137296-101137318 CCATGTGTGTGATGAGAAGTGGG - Exonic
1073481404 10:103788249-103788271 CCATTTTGCAGATGGGAAGGTGG + Intronic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1079508391 11:21181424-21181446 CCATATAGCTGTTATGAAGTAGG - Intronic
1080850751 11:36067587-36067609 CCATATGATTTATGGTAAGTTGG - Intronic
1087446346 11:98259268-98259290 CCATATTGCTGGGAGGAAGTGGG + Intergenic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1089554831 11:119310601-119310623 CCATGTGGCTGATGGAAGCTGGG + Intronic
1090169374 11:124585432-124585454 CCATTTGGTTGATGCTAAGTGGG + Intergenic
1091245342 11:134089014-134089036 CCATATAGGTGATTGTAAGTTGG + Intronic
1096063448 12:48721074-48721096 CCACATGGCTGAAGGCAAGGAGG + Intergenic
1096110687 12:49027375-49027397 GCATATGGGTGAGGGGAAGGAGG - Intronic
1096803014 12:54123939-54123961 CCAGATGAGTGATGGGAAGAGGG - Intergenic
1097322843 12:58245353-58245375 TGACATGGCTGATGGGTAGTCGG - Intergenic
1099806099 12:87521225-87521247 CCTTATGGGGGATGGGAAGGAGG - Intergenic
1100220751 12:92502427-92502449 GCACATGGCTGAAGGGAGGTGGG - Intergenic
1102870108 12:116407509-116407531 CCATTTCACTGATGGGAAGATGG - Intergenic
1103398898 12:120629006-120629028 CCATCTGGCAGGAGGGAAGTGGG + Intergenic
1104769065 12:131349265-131349287 ACATCTGGCTGATGGTAAATGGG - Intergenic
1105438976 13:20400214-20400236 CCATATGGCTGAGTGGCAGGAGG - Intergenic
1105738342 13:23295800-23295822 TCCTATGGCTGATGTGATGTGGG - Intronic
1108230059 13:48328544-48328566 GGAAATGGCTGATGGGAAGGCGG - Intronic
1109771010 13:66973232-66973254 GTATATGGCTGGTGGGAATTAGG - Intronic
1112894499 13:104282428-104282450 CTATATGGCAAATGGGAATTTGG + Intergenic
1114817519 14:25978092-25978114 CCATATAGCTCTAGGGAAGTTGG + Intergenic
1114922146 14:27344977-27344999 CCATAAGGATGATGGAATGTTGG - Intergenic
1118746528 14:68777494-68777516 CCACATGGCTGATGCCAAATGGG + Intergenic
1119602084 14:75982930-75982952 CCAGATGGGTGAGGGGAAGTCGG + Intronic
1121005746 14:90489587-90489609 CCATATGGGTGATGGAAAGCTGG + Intergenic
1121636664 14:95458362-95458384 CCATATGGATGAGGGGACTTGGG - Intronic
1121881031 14:97500302-97500324 CCATATTGCCGATGGCAAATTGG + Intergenic
1122060017 14:99130787-99130809 CCATGTGGCTGACGGGATGAAGG + Intergenic
1122159581 14:99773666-99773688 GCATCTGGGTGATGGCAAGTAGG - Intronic
1122169725 14:99862312-99862334 CCATCTGGCTGAGGGGGTGTTGG + Intronic
1122200306 14:100118637-100118659 CTATATGACTGATGGGGAGTGGG - Intronic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124480135 15:30072091-30072113 CCATCTGGTTGATGGGCAATTGG + Intergenic
1125363128 15:38885823-38885845 ACATATGCCTTATGGGAGGTAGG - Intergenic
1126692535 15:51298942-51298964 CCACATGGCTAGTGGGAAGTTGG + Intronic
1131457333 15:92592212-92592234 CAAAATAGCTGATTGGAAGTAGG - Intergenic
1133235939 16:4387466-4387488 CCATGTGGCTGGTGTGGAGTAGG + Intronic
1134297986 16:12963468-12963490 CCATATGGCTGGCAGGGAGTTGG + Intronic
1135509234 16:23068251-23068273 GCATTTGGCTGCTGGGAAGCTGG + Exonic
1137246879 16:46712866-46712888 CCATATGGCTGATGGGAAGTGGG - Intronic
1137765825 16:50976914-50976936 TGCTATGGCTGGTGGGAAGTGGG + Intergenic
1138574831 16:57900953-57900975 CCATTTTCCTGATGGGAAGATGG + Intronic
1139989440 16:70927767-70927789 CCATGTGGCTGTTGAGATGTCGG - Intronic
1144586162 17:16489177-16489199 CCATATGGCTGGTGGGGACTCGG - Intronic
1145788833 17:27611556-27611578 CCATCTGGCAGATTGGAAGCGGG + Exonic
1146839603 17:36141438-36141460 CCACATGGCTGATGGAACGATGG + Intergenic
1146839802 17:36143137-36143159 CCACATTGCTGGTGGAAAGTAGG + Intergenic
1149453285 17:56766799-56766821 CAATCTGGATGATGGGAGGTGGG + Intergenic
1150164479 17:62928271-62928293 GCAAATGGCTGTTGGGATGTTGG + Intergenic
1151272388 17:73007049-73007071 CCATGTCGCTGATGGGCTGTAGG - Intronic
1151451836 17:74202874-74202896 CCCTAGGGCTGATGGTGAGTGGG - Intergenic
1151453292 17:74212308-74212330 ACATATGGCTGCTGGGGAGTGGG - Intergenic
1151554251 17:74838604-74838626 CCACATCGCTGATGCCAAGTGGG + Exonic
1151630832 17:75309698-75309720 CCAGATGGCTGCAGGGCAGTGGG - Intergenic
1151900153 17:77007070-77007092 CCATCTATCTGATGGCAAGTCGG - Intergenic
1152189268 17:78878705-78878727 CCAGATGCCTGCAGGGAAGTGGG + Intronic
1154395420 18:13983211-13983233 CCACTTAGCTCATGGGAAGTGGG + Intergenic
1157901560 18:51523009-51523031 TCATATGGCTGACAGGAAGGTGG + Intergenic
1159418283 18:68182300-68182322 CTATATGGCTGATGTAAAGAAGG - Intergenic
1162085893 19:8248901-8248923 ACATATGGATGATGGGTAGATGG + Intronic
1164730209 19:30497901-30497923 ACATATGGCTGATGGGGACAGGG - Intronic
1164749228 19:30639472-30639494 CCATGTGGCTACTGGGAACTTGG - Intronic
1167289195 19:48615171-48615193 CCACCTGGCTGTTGGGAAGGAGG + Intergenic
926022124 2:9505560-9505582 CTAAATGGCTGATGTGAACTTGG + Intronic
928336501 2:30402869-30402891 TCATAAGGCTGGTGGGAAGTAGG + Intergenic
928951695 2:36818994-36819016 CCAAGTGGCTGCTGAGAAGTTGG - Intergenic
932282093 2:70502287-70502309 CACTTTGGCTGTTGGGAAGTAGG - Intronic
932403619 2:71499563-71499585 CCGTATGGCAGAAGGGAAGGAGG - Intronic
932887814 2:75562718-75562740 CCATATGCCTGCTGGAAAGCTGG - Intronic
934857545 2:97738610-97738632 CCTGTTGTCTGATGGGAAGTTGG - Intronic
936067275 2:109342176-109342198 AGGTATGGCTGATGAGAAGTGGG - Intronic
940289841 2:152067708-152067730 CCCTATTGCTGGTGGTAAGTAGG + Intronic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
941590767 2:167417376-167417398 CCTTCTAGCTGATGGGAACTGGG - Intergenic
943847953 2:192675759-192675781 GAATATGGCTGATCGGAAGTAGG - Intergenic
944512516 2:200478748-200478770 CCATGTGGCAGTTGGGCAGTTGG + Exonic
946348270 2:219128931-219128953 CCATATGGGGGATAGAAAGTAGG - Intronic
946661441 2:222004612-222004634 TCATATTGCTGATGGGAACCCGG - Intergenic
946988238 2:225299193-225299215 CCAAATGGAAGCTGGGAAGTTGG - Intergenic
947819612 2:233060839-233060861 CCATACAGCTCATGGGAAGCTGG - Intronic
948021678 2:234738465-234738487 TCCCATGGCTGCTGGGAAGTGGG + Intergenic
948462638 2:238137764-238137786 CCACATGGCCGATGGGTAGAGGG + Intergenic
948924767 2:241088431-241088453 CCACAGAGCTGCTGGGAAGTGGG + Exonic
1169346656 20:4834348-4834370 CCAGATGACTGATGGGAAGTGGG - Intergenic
1169698967 20:8425281-8425303 CTATGCGGCAGATGGGAAGTTGG - Intronic
1171793746 20:29550649-29550671 CCAGATGAGTGATGGGAAGAGGG + Intergenic
1171847825 20:30288459-30288481 ACTTATGGCCGCTGGGAAGTTGG - Intergenic
1171854724 20:30333741-30333763 CCAGATGAGTGATGGGAAGAGGG - Intergenic
1172611829 20:36258279-36258301 CCATTTTGCTGATGGGAAAATGG + Intronic
1172742550 20:37180143-37180165 CCATTTGACAGATGAGAAGTTGG + Intronic
1172884075 20:38219758-38219780 CCAGATGGCTCCTGGGAGGTGGG + Exonic
1173913929 20:46692684-46692706 CCACATGGCTGCTGGCAGGTTGG + Intergenic
1174653396 20:52148981-52149003 CCTTTTGGTTGTTGGGAAGTTGG - Intronic
1176260641 20:64177777-64177799 CCATGGGGCTGAGGGGAAGGTGG - Intronic
1177167721 21:17621665-17621687 TCACATGGCTGAAGGCAAGTGGG - Intergenic
1178694187 21:34779076-34779098 CCTTACTGCTGATGGGCAGTGGG - Intergenic
1181338444 22:22159383-22159405 ACAGAGGGCAGATGGGAAGTTGG + Intergenic
1182429368 22:30290953-30290975 CCATGGGGCTGAGGGGAAGGAGG + Intronic
1184036501 22:41920567-41920589 CCATTTTGCAGATGGGAAGAGGG + Intergenic
1184629147 22:45762572-45762594 CCAGCTGGCTGAAGGGAAGCTGG + Intronic
1184966929 22:47983449-47983471 CCATTTGGCTGATGGGTTTTGGG + Intergenic
949265117 3:2148093-2148115 CCATATGGTTGATTGGTTGTGGG + Intronic
949371957 3:3344938-3344960 TCATATGAATGATGGGAGGTGGG - Intergenic
949790511 3:7786992-7787014 CCAGATGGCTGATTGAAAGTGGG - Intergenic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
950179496 3:10901268-10901290 GCATAGGGCAGATGGGCAGTTGG - Intronic
951226106 3:20123206-20123228 CCAAATGGTTCATGGGGAGTGGG - Intronic
951516496 3:23565634-23565656 CCCTCTGGCTAAAGGGAAGTTGG + Intronic
954700381 3:52447755-52447777 AGGGATGGCTGATGGGAAGTGGG - Intergenic
955090323 3:55744034-55744056 CTGCATGGCAGATGGGAAGTTGG + Intronic
955355337 3:58226391-58226413 CCATGTGGTTCATGTGAAGTAGG + Intergenic
955824671 3:62932929-62932951 CCATATGGCTTAAGTGAAGCCGG - Intergenic
959041213 3:101424706-101424728 CAATGTGGCTGATGGGGAGCAGG - Intronic
960918665 3:122724015-122724037 CCATTTGGCTGGCAGGAAGTTGG + Intronic
961412764 3:126734755-126734777 CCTTAAGGCTGAGGGGCAGTTGG + Intronic
961810279 3:129518182-129518204 CTATAAGGCTGAGGGGATGTGGG - Intronic
962158193 3:132971344-132971366 CCATATGGCTATTGTGAACTTGG - Intergenic
966004058 3:174987035-174987057 CCAAATGGTCAATGGGAAGTGGG - Intronic
969046582 4:4340878-4340900 CCATGTGGCTGCTGCCAAGTAGG + Intergenic
969093129 4:4711501-4711523 CCACATGGCTGATCTGCAGTGGG + Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
970119138 4:12732999-12733021 CTTTATGGCTGATGGTAAGGCGG - Intergenic
970673607 4:18423028-18423050 CCAAATGACAGATGAGAAGTGGG - Intergenic
974882529 4:67777376-67777398 CCATATGGCAGAGGGGATATAGG - Intergenic
975533840 4:75428057-75428079 TCACATGGCTGTTGGTAAGTTGG + Intergenic
975860498 4:78671677-78671699 CTATAAGGCTGATGGGATATTGG - Intergenic
980205246 4:129711049-129711071 CCATAAGGCTCAGGGGAAGTAGG - Intergenic
980469525 4:133233737-133233759 CCAAATGGCTCCTGGGAAATGGG + Intergenic
982201271 4:152963308-152963330 CTATAGGGCTGAAGGGAAGTGGG + Intronic
982771341 4:159400189-159400211 CCATTTGACAGATGGGAAATGGG + Intergenic
986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG + Intergenic
987645766 5:20671194-20671216 CCACATGGCTGCTGGGGAATGGG - Intergenic
988211561 5:28211158-28211180 TCATATTTCTGATGAGAAGTTGG - Intergenic
989285133 5:39690691-39690713 CCTCATGGCAGATGAGAAGTGGG + Intergenic
989291760 5:39775891-39775913 TGCTATCGCTGATGGGAAGTGGG - Intergenic
990128924 5:52555354-52555376 CCATTTGGCTGATGAGAAAATGG - Intergenic
990825066 5:59890220-59890242 CCATTTGGATGATGGTAAGATGG + Intronic
991955720 5:71994480-71994502 CAAGATGGCTAATGGGGAGTGGG - Intergenic
992536454 5:77709521-77709543 CCATCTGGCTGTTGGCAAGATGG + Intronic
992745028 5:79811099-79811121 CCAGATGGCTGAGTAGAAGTTGG + Intergenic
996058625 5:119008266-119008288 TCATATGGTTGTTGGGAGGTGGG - Intergenic
1001178480 5:169495529-169495551 CCATGTAGCTGCTGAGAAGTTGG - Intergenic
1005782171 6:29203220-29203242 CCAGATGGCTCCTGGGAAATTGG - Intergenic
1006660154 6:35634792-35634814 ACATGTGGCTTATTGGAAGTTGG - Intronic
1008928831 6:56916000-56916022 CCATAAGGCAGATGGGAAGATGG + Intronic
1010180110 6:73076447-73076469 ACATCTGAGTGATGGGAAGTAGG - Intronic
1011381197 6:86743955-86743977 CCATATCACTGTTGGTAAGTTGG - Intergenic
1014509126 6:122299088-122299110 CCATATGATCGATGGGAAGCAGG - Intergenic
1015790852 6:136962839-136962861 CCATCTGGCTGATTAGAAGTGGG - Intergenic
1018314742 6:162545513-162545535 CCAAATGCCTGATGGGAATTGGG - Intronic
1018423381 6:163659517-163659539 CAATATTGCTGGTGAGAAGTTGG + Intergenic
1024451601 7:49552052-49552074 CCAAATGGCTGATGTTATGTGGG - Intergenic
1024670882 7:51593407-51593429 CCATATGGCTAGAGGCAAGTCGG - Intergenic
1025193101 7:56911295-56911317 CCATCTGGCAGATGGCACGTGGG + Intergenic
1025678843 7:63665625-63665647 CCATCTGGCAGATGGCACGTGGG - Intergenic
1036212112 8:6850672-6850694 GCATATGTATGGTGGGAAGTGGG - Intergenic
1039327575 8:36502171-36502193 CCAAATGGCTGAGAGGAAGTTGG + Intergenic
1045717839 8:105069407-105069429 CCTTAAGGCTGTTAGGAAGTAGG + Intronic
1046723962 8:117654710-117654732 CCATCTACCTGATGGTAAGTCGG + Intergenic
1048272573 8:133041262-133041284 CCATAAACCCGATGGGAAGTGGG - Intronic
1048374101 8:133807127-133807149 GCATAAGCCAGATGGGAAGTAGG - Intergenic
1052185388 9:25587689-25587711 CTGTATGGCTGATGAAAAGTGGG + Intergenic
1053785958 9:41653105-41653127 ACTTATGGCCGCTGGGAAGTTGG - Intergenic
1053792549 9:41697022-41697044 CCAGATGAGTGATGGGAAGAAGG - Intergenic
1054174673 9:61867038-61867060 ACTTATGGCCGCTGGGAAGTTGG - Intergenic
1054180962 9:61909043-61909065 CCAGATGAGTGATGGGAAGAAGG - Intergenic
1054656629 9:67672099-67672121 CCAGATGAGTGATGGGAAGAAGG + Intergenic
1054662865 9:67713755-67713777 ACTTATGGCCGCTGGGAAGTTGG + Intergenic
1054934157 9:70668933-70668955 CCATAGCCCTGCTGGGAAGTCGG + Intronic
1054969047 9:71063187-71063209 CCAAATGGCTCATGGGAGGAAGG - Intronic
1056731110 9:89167446-89167468 CCATATGACTGATGGGATCATGG - Intronic
1058470886 9:105277664-105277686 CAATAGGGCTGATGGGAGTTGGG + Intronic
1059551205 9:115231320-115231342 CCATATGGCTGTTGGGAATGGGG + Intronic
1060175158 9:121492322-121492344 CCATTTGGCTGATGGGGAAACGG + Intergenic
1188268352 X:28106871-28106893 GCATGTGGCTGATGGAAGGTAGG + Intergenic
1189708175 X:43780659-43780681 CCAGCTGGGTGAGGGGAAGTGGG - Intronic
1190438136 X:50448259-50448281 CCAAATGGCTGATCTGAAATAGG + Intronic
1192904708 X:75538684-75538706 CAAAATGGCAGATGGGAAGGTGG - Intergenic
1195613743 X:106896458-106896480 CCATTTGGCAAAAGGGAAGTGGG + Intronic
1195861098 X:109384161-109384183 ACACATGAGTGATGGGAAGTGGG + Intronic