ID: 1137247121

View in Genome Browser
Species Human (GRCh38)
Location 16:46714776-46714798
Sequence TCCGTGTGCCCTCATTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137247121_1137247124 8 Left 1137247121 16:46714776-46714798 CCATGAGAATGAGGGCACACGGA 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1137247124 16:46714807-46714829 ACCCTCACTGACCTGCACCCTGG 0: 1
1: 0
2: 2
3: 30
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137247121 Original CRISPR TCCGTGTGCCCTCATTCTCA TGG (reversed) Intronic
901225768 1:7612173-7612195 TCCGTGTGACCTGATTCTTCTGG - Intronic
902256929 1:15195564-15195586 CCGGTTTGCCCTCATTCTCTAGG + Intronic
902321038 1:15666348-15666370 TCTGTGTGCCCTCCATCTCCAGG - Exonic
902367846 1:15989235-15989257 TCCCTGTGCCCTCAAGGTCAGGG + Intergenic
912638661 1:111322549-111322571 TCCCTGTGCCCACCATCTCATGG - Intergenic
915597492 1:156903938-156903960 TCTGTGTCCCCTCCTTCTCCTGG + Exonic
916019280 1:160778209-160778231 ACCCTGTGCCTTCATTCTCTGGG - Intergenic
923346454 1:233058039-233058061 TCCGAGAGCTTTCATTCTCATGG - Intronic
924923078 1:248650785-248650807 TCTCTTTGCCCTCATTCTCCTGG - Exonic
1065917735 10:30366747-30366769 ACCATGTGCCCTCATGCCCAGGG - Intronic
1068403816 10:56564261-56564283 TCTGTGTGCCCTGATTCTTCTGG + Intergenic
1068744627 10:60516319-60516341 TACCTGTGCCCTCAGTCCCATGG - Intronic
1069769743 10:70890587-70890609 TTTGTGTGCCCACATGCTCACGG - Intergenic
1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG + Intronic
1073990670 10:109258769-109258791 TTCATGTTCACTCATTCTCAAGG - Intergenic
1074167533 10:110897212-110897234 TCTGTGTGGCTTTATTCTCAAGG + Intronic
1076451770 10:130561323-130561345 TCCTGGGGCCCCCATTCTCAGGG + Intergenic
1076451849 10:130561638-130561660 TCCTGGGGCCCCCATTCTCAGGG + Intergenic
1079402084 11:20113935-20113957 TCCCTGTGGCCTCAATCTCCCGG - Intronic
1079843558 11:25434582-25434604 TCTTTGTGCCCTCACCCTCATGG + Intergenic
1083174601 11:60941712-60941734 TCCTTGTCCCCTCTTTCTCTGGG - Intronic
1085136187 11:74090936-74090958 TCCTTGTGTCCTCATTCTTCAGG - Exonic
1086962858 11:92997700-92997722 TCACTGTGCTCTCATTCTCCTGG + Intergenic
1090866348 11:130704137-130704159 TCCGTGTTCACTCATTCCCAAGG + Intronic
1092834417 12:12474051-12474073 TCCGTGTTCTGTCATTCACATGG - Intergenic
1093682403 12:22017501-22017523 TCTGTGTACCATCATTCTTATGG - Intergenic
1094675538 12:32616402-32616424 GCCATGTGACCTCATTCTCCTGG - Intronic
1095836998 12:46649548-46649570 TCCTGGTGTCCTCATCCTCATGG + Intergenic
1097363097 12:58679925-58679947 TACCTGAGCCCTCATTCTGAGGG - Intronic
1098158735 12:67626701-67626723 ACCATGTCCCCTGATTCTCAAGG + Intergenic
1098577804 12:72063531-72063553 TCCTTGTGCCCTCAATGTCCTGG - Intronic
1099456338 12:82867091-82867113 TCAGTGTGCCCTTGTTCTCTGGG + Intronic
1101480143 12:105088857-105088879 TCACTGTGGCCTCAATCTCATGG + Intergenic
1104807605 12:131599434-131599456 TCCGTGTGCCATGAATCACAGGG + Intergenic
1113358967 13:109610686-109610708 GCTATGTGGCCTCATTCTCATGG - Intergenic
1115497980 14:34025800-34025822 TCCCTGTGGCCTCCTCCTCAGGG + Intronic
1115952633 14:38738036-38738058 TCTCTGTGCCCTCTTTCTCATGG - Intergenic
1116688971 14:48080677-48080699 TCCGTCTGCCCTCCTTATCTTGG + Intergenic
1118222783 14:63870800-63870822 TCCGTGTGCATACATTCTAAAGG - Intronic
1118849579 14:69573525-69573547 TCCGTGCCCCCTGATTCCCAGGG - Exonic
1119718248 14:76873814-76873836 TCTGTGTGGCCAAATTCTCAAGG + Intergenic
1122714112 14:103683493-103683515 TCCGTGTGGCTTCATGTTCATGG + Intronic
1125597365 15:40895391-40895413 TCCCTATGCCCTCATTCTCCTGG - Intronic
1127447575 15:59080971-59080993 TCTGCCTGCCCGCATTCTCATGG + Exonic
1129038261 15:72664093-72664115 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129211627 15:74073138-74073160 GCCATGTGCCCTCATGCCCAGGG - Intronic
1129398776 15:75267946-75267968 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129402384 15:75292222-75292244 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129728750 15:77917413-77917435 ACCATGTGCCCTCATGCCCAGGG - Intergenic
1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG + Intergenic
1132116754 15:99142655-99142677 TCCTTGGCCCCTCATTCTCTAGG + Intronic
1132956669 16:2598015-2598037 TCCGTGTGCCCTCGTTGCCGTGG + Exonic
1135417995 16:22283745-22283767 TCCGTGTGCCCTCTCCCTCCAGG - Intronic
1136682294 16:31975487-31975509 TCTGAGTGCCCTCAGTCTGATGG + Intergenic
1136782551 16:32916655-32916677 TCTGAGTGCCCTCAGTCTGATGG + Intergenic
1136887243 16:33937195-33937217 TCTGAGTGCCCTCAGTCTGATGG - Intergenic
1137247121 16:46714776-46714798 TCCGTGTGCCCTCATTCTCATGG - Intronic
1138076999 16:54052586-54052608 TCTGTGTGCCTTCCTTTTCAAGG + Intronic
1141408817 16:83818123-83818145 TCTGTGAGCCCTCATCCCCAGGG + Exonic
1203085210 16_KI270728v1_random:1180643-1180665 TCTGAGTGCCCTCAGTCTGATGG + Intergenic
1142479266 17:208162-208184 TCCGTATGCCCTGATTTTTACGG + Intergenic
1144879076 17:18421668-18421690 TCCGGGTGTCCTGCTTCTCAGGG - Intergenic
1154027065 18:10717877-10717899 TGTGTGTGCCTTCATTCTGACGG + Intronic
1156528185 18:37788271-37788293 TTAAAGTGCCCTCATTCTCATGG - Intergenic
1157952869 18:52059816-52059838 TCCGTGTCCCTTCTTTCACAAGG + Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1166704015 19:44898346-44898368 TCTGTGTGCCCTCAGTCTCGTGG + Intronic
1167741243 19:51326117-51326139 TCCCTGGATCCTCATTCTCAGGG + Intronic
927895416 2:26778553-26778575 CCTGTGTGGCCTCAGTCTCAGGG - Exonic
929085603 2:38164639-38164661 TCCAGTTGCCCACATTCTCAGGG - Intergenic
937725719 2:125163525-125163547 TCCGTGTGCCTTCATTATCTGGG + Intergenic
938768908 2:134483090-134483112 TCAGAGTGCCCTCATTGTCACGG - Intronic
941719134 2:168794711-168794733 ACAGGGTGCCCTCAGTCTCAGGG + Intronic
946076479 2:217077766-217077788 TTCCTGAGCCCTCATTCTCCAGG + Intergenic
1173672285 20:44807134-44807156 TCCTTTTGCCCTCTTTCACAAGG - Intronic
1175913160 20:62414141-62414163 CCCTGGTCCCCTCATTCTCAGGG + Exonic
1178891105 21:36521839-36521861 TCCCTGTCCCTTCACTCTCAAGG + Intronic
1179075389 21:38115494-38115516 TCCATGTGCCCTCTCTCACAGGG - Intronic
1182550244 22:31096990-31097012 TCCGTGTGCCATCATCTGCAGGG - Exonic
1183791345 22:40072986-40073008 TACGTGTGCCCTCATTTGAAAGG - Intronic
949366769 3:3290311-3290333 TCCATGTGGCCCCTTTCTCAGGG + Intergenic
951596836 3:24327602-24327624 TTCCTGTGTCCTTATTCTCAAGG + Intronic
952415250 3:33084203-33084225 TCCATGTTCCCTCAGCCTCAGGG - Intronic
952727414 3:36601566-36601588 TCCTTGTGCCCTGATTGTAAGGG - Intergenic
956613087 3:71144280-71144302 TCTCTGTGGCCTCTTTCTCAGGG + Intronic
963976021 3:151481206-151481228 GCCGTGTGACCTCACTCTCCAGG + Intergenic
965465195 3:169020873-169020895 TCTGTGTGAACTCTTTCTCATGG - Intergenic
967429773 3:189368626-189368648 TCAGTCATCCCTCATTCTCATGG - Intergenic
967764347 3:193261945-193261967 TCTGTCTGTCCTCCTTCTCACGG - Intronic
969418283 4:7075041-7075063 TCCCTGTGCCCTGATTCTGGGGG + Intergenic
975736493 4:77386218-77386240 TCCGTGGGTCTTCATTCTGAAGG + Intronic
975984965 4:80193917-80193939 TCAGTGTGTTTTCATTCTCATGG + Intronic
976658811 4:87517860-87517882 TCCAAGTAGCCTCATTCTCATGG + Intronic
977537838 4:98276783-98276805 TCCTTGGGCCCACATTCTTAGGG - Intronic
977708030 4:100093234-100093256 TCCATGAGCCCTGATTTTCATGG - Intergenic
978639494 4:110852904-110852926 TCTCTGTGTCCTCATTCTTAGGG - Intergenic
981705551 4:147655615-147655637 TCACTGTGGCCTCAATCTCAGGG + Intronic
981944459 4:150325102-150325124 TCTGTCTGTCTTCATTCTCATGG + Intronic
990057503 5:51602233-51602255 ACCATATGCCCTCATTCACACGG + Intergenic
990076008 5:51846852-51846874 TCCATGAGCCATAATTCTCATGG + Intergenic
990443081 5:55866132-55866154 TCCCTGTGCCCTCAAAGTCAGGG - Intronic
995417123 5:111924292-111924314 TCTGAGTTCTCTCATTCTCAGGG - Intronic
1004785802 6:18966019-18966041 CTCTTGTCCCCTCATTCTCATGG - Intergenic
1008613055 6:53201878-53201900 TCTTTGTGCCTTCATTCTGAAGG + Intergenic
1012153832 6:95791153-95791175 TCCGTGCAGCCTCAATCTCATGG - Intergenic
1014717715 6:124885923-124885945 TCAGTGTGCCCACATAGTCAGGG - Intergenic
1016309231 6:142715306-142715328 ACAGTGTGTCCTCATTCTGAAGG + Intergenic
1016539329 6:145145847-145145869 TCTCTGTACCCTGATTCTCAGGG - Intergenic
1020228920 7:6301922-6301944 TCCCTGCGCCCTCAATCTCCTGG - Intergenic
1021737135 7:23650862-23650884 TCCATATTCCCTCATTCCCAGGG + Intergenic
1021809175 7:24386680-24386702 TCCCTGTGCCATCTTTCTCAGGG + Intergenic
1028450306 7:90974542-90974564 TCCTTCTTCCCTAATTCTCAAGG - Intronic
1029657655 7:101937470-101937492 TCCCTTTTCCCTCATTCTGAAGG - Intronic
1033273598 7:139955088-139955110 CCTGTGTGCCCTCCTTCCCAGGG + Intronic
1038436386 8:27539689-27539711 TCAGTGAGCCCACAGTCTCACGG + Intronic
1039436658 8:37564151-37564173 TCCGTGTGCCCCCAGCCTCCGGG - Intergenic
1042355591 8:67824205-67824227 TCCATGTGCACGCATTGTCAGGG + Intergenic
1046731452 8:117730676-117730698 TCCCTTTGCCCTCAGCCTCATGG + Intergenic
1047062985 8:121248943-121248965 ACCGTGTGCACACATTCTCCTGG - Intergenic
1052031241 9:23631278-23631300 ACCTTGTGCCCTCACTCTAAGGG - Intergenic
1052449966 9:28616553-28616575 TCTGTGTGCCCTCATACACATGG - Intronic
1057755729 9:97833576-97833598 TCCCTGTGACCTCAGTTTCATGG - Intergenic
1060938825 9:127531677-127531699 GCCCCGTGCCCTCAATCTCATGG + Exonic
1186102849 X:6174976-6174998 TCTTTGTGTCCTCATTCTGAAGG + Intronic
1189024933 X:37384263-37384285 TCCGTGTCCCTTCATTTCCATGG + Intronic
1192271215 X:69581277-69581299 TTCCTGTACCCTAATTCTCACGG - Intergenic