ID: 1137248592

View in Genome Browser
Species Human (GRCh38)
Location 16:46726850-46726872
Sequence GAGAAGTCCCTTCCGCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137248589_1137248592 15 Left 1137248589 16:46726812-46726834 CCTTTTGTGTGTCTGTGAGTCAT 0: 1
1: 0
2: 4
3: 49
4: 532
Right 1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 44
1137248590_1137248592 -9 Left 1137248590 16:46726836-46726858 CCAGCTTGCTCACAGAGAAGTCC 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137248592 Original CRISPR GAGAAGTCCCTTCCGCACGG AGG Intronic
900991512 1:6100376-6100398 GGGAAGTCCCTTCCCAACGGAGG + Exonic
905452757 1:38067593-38067615 AAGATGTCCCTTCCTCAGGGAGG + Intergenic
912550199 1:110480404-110480426 GAGAAGTCCCGTCTGCAAGTGGG + Intergenic
1067110436 10:43396614-43396636 GTGGGGTCCCTTCCGCAAGGTGG + Exonic
1070801405 10:79246485-79246507 GAGGAGTTCCTTCCCCATGGAGG - Intronic
1072743776 10:97926085-97926107 GAAAAGTCCCTTCCGCTGAGTGG + Intronic
1073815347 10:107200354-107200376 GAGAAGTCTCCTCCGCATGGGGG - Intergenic
1082003567 11:47408090-47408112 GGGAAGTGCCTGCCGCAGGGAGG - Intronic
1084678387 11:70650252-70650274 GAGAAATCTCTTCCACAAGGAGG - Intronic
1088684144 11:112271039-112271061 TAGAAGTCCCTTCCCCAGGCAGG + Intergenic
1089671499 11:120060356-120060378 TAGCAGTCCTTTCCCCACGGAGG - Intergenic
1091222002 11:133935323-133935345 GAGCAGTTCCTTCTGAACGGTGG - Intronic
1093013341 12:14131130-14131152 TAGATGTCCCTTCCACAAGGAGG + Intergenic
1103496448 12:121366317-121366339 GAGAATTCCTTTCCCCAGGGAGG - Intronic
1104139220 12:125971626-125971648 GAGAAGTCCCTTCCTGCTGGAGG - Intergenic
1114710916 14:24777439-24777461 GAGAAGTCACTTCGGCAGGGAGG - Intergenic
1115906450 14:38208392-38208414 CAGAAGCCCCTAACGCACGGTGG + Intronic
1116508837 14:45718815-45718837 GAGAAGTCTCTTCCCCATGGTGG - Intergenic
1132517917 16:374478-374500 GAGAAGCCCCTTCCTCACCCAGG + Intronic
1134073842 16:11276810-11276832 CGGAAGTCCCTTCCACATGGTGG - Intronic
1136047777 16:27628799-27628821 CAGAAGTGCCTCCCACACGGAGG + Exonic
1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1163518558 19:17779078-17779100 CAGATGTCCCTTCCTCAGGGAGG - Intronic
1165309923 19:35023610-35023632 GGGAAGTGCCTGCCGCACGGTGG - Intronic
1167591997 19:50409175-50409197 CAGCAGCCCCTTCCGCACTGAGG - Exonic
926309337 2:11663313-11663335 GGGAAGTCTCATCTGCACGGGGG - Intronic
926814490 2:16786816-16786838 GAGAGGTCCCTTCTGCAAAGAGG + Intergenic
946565695 2:220962192-220962214 GAGAAGTCCCATCTGCAAGCTGG - Intergenic
1173902968 20:46604561-46604583 GGGAAGTCCCTTCCACACCACGG + Intronic
1180755258 22:18156621-18156643 GAGATGTCCGTTCCTCCCGGTGG - Intronic
1181745156 22:24950970-24950992 CAGAAGTCCCTTCCTCCAGGAGG + Intergenic
1184450950 22:44582420-44582442 GAGAAGTCCCTGCCCCACTCTGG - Intergenic
956880831 3:73509211-73509233 GCAAAGTCACTTCCTCACGGGGG - Intronic
977234824 4:94495593-94495615 CAGAAGTCACTTCTGCAGGGAGG - Intronic
985623406 5:968675-968697 GCAAAGTCCCTTCCACACAGTGG + Intergenic
987476523 5:18399024-18399046 GAGTTGTCCCTTCCTCCCGGTGG + Intergenic
1002701590 5:181128617-181128639 GGGAAGAGCCTTCTGCACGGAGG - Intergenic
1002704130 5:181148859-181148881 GGGAAGAGCCTTCTGCACGGAGG + Intergenic
1005748933 6:28865844-28865866 GAAAAATCACTTCCGCACCGTGG + Intergenic
1013888328 6:114998357-114998379 GAGAAGTCTCTTCCGATCGAAGG - Intergenic
1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG + Intergenic
1019540328 7:1548330-1548352 GAGAGGTCCCGCCAGCACGGGGG - Intronic
1025035723 7:55591555-55591577 GAGAAGCCCCTTCCCCTGGGAGG + Intergenic
1037675348 8:21046189-21046211 AAGAAGTACCTGCCGCACAGGGG + Intergenic
1048447403 8:134502256-134502278 GAGAAGTCCCTTCTGCAGAGCGG + Intronic
1053603642 9:39634639-39634661 GAGAAGGCCCTTCCACACTATGG + Intergenic
1054249898 9:62707780-62707802 GAGAAGGCCCTTCCACACTATGG - Intergenic
1054564008 9:66742302-66742324 GAGAAGGCCCTTCCACACTATGG - Intergenic
1057269037 9:93636778-93636800 GAGAGGTCCCTTCCACCCAGCGG - Intronic
1060113972 9:120926650-120926672 GAGAAGTCACTTCCTCACAGTGG + Exonic
1193041604 X:77009667-77009689 GAGAAGTCCCTTCCACTCTTTGG + Intergenic