ID: 1137248743

View in Genome Browser
Species Human (GRCh38)
Location 16:46727813-46727835
Sequence CACCCCGCCGGGCCTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 323}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137248736_1137248743 9 Left 1137248736 16:46727781-46727803 CCTCCCGAAGTGCTGAGATTATA 0: 33
1: 2798
2: 53264
3: 349513
4: 259944
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248738_1137248743 6 Left 1137248738 16:46727784-46727806 CCCGAAGTGCTGAGATTATAGGC 0: 43
1: 2360
2: 41536
3: 274711
4: 288888
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248732_1137248743 22 Left 1137248732 16:46727768-46727790 CCACCCACCTCGGCCTCCCGAAG 0: 431
1: 29459
2: 115327
3: 165579
4: 187530
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248733_1137248743 19 Left 1137248733 16:46727771-46727793 CCCACCTCGGCCTCCCGAAGTGC 0: 598
1: 39993
2: 188867
3: 270649
4: 197220
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248739_1137248743 5 Left 1137248739 16:46727785-46727807 CCGAAGTGCTGAGATTATAGGCG 0: 605
1: 17172
2: 168667
3: 295390
4: 207048
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248735_1137248743 15 Left 1137248735 16:46727775-46727797 CCTCGGCCTCCCGAAGTGCTGAG 0: 92
1: 7854
2: 139194
3: 280069
4: 219867
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323
1137248734_1137248743 18 Left 1137248734 16:46727772-46727794 CCACCTCGGCCTCCCGAAGTGCT 0: 1410
1: 92511
2: 186343
3: 138236
4: 81632
Right 1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG 0: 1
1: 0
2: 3
3: 27
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137248743 Original CRISPR CACCCCGCCGGGCCTGCCAT TGG Intronic
900147103 1:1163150-1163172 CACCCACCCGGGCCTGGCACAGG + Intergenic
900555067 1:3276271-3276293 ATCCTCGCCAGGCCTGCCATTGG + Intronic
900963966 1:5944679-5944701 CACCGCGCCCGGCCAGTCATTGG - Intronic
901512058 1:9722377-9722399 CACCCCGCCTGTACTGCCCTGGG + Intronic
901606329 1:10462144-10462166 CACCGCGCCCAGCCTGCCATGGG + Intronic
901812693 1:11776809-11776831 CACCTCCCAGGGCCTGACATTGG - Intronic
902290037 1:15429444-15429466 CCCCCTGCCGGGCATGCCGTGGG + Exonic
903587504 1:24427251-24427273 CACCCTGCAGTGCCTGGCATAGG - Intronic
903799768 1:25957922-25957944 CACCGCGCCCGGCCTGTCTTGGG - Intergenic
904577933 1:31517450-31517472 CCCCTCGCAGGGCCTGCAATGGG + Intergenic
904664641 1:32110351-32110373 CACCGCGCCTGGCCTGGAATTGG + Intronic
905708361 1:40079682-40079704 CACCACGCCCGGCCTTCTATAGG + Intronic
905897561 1:41558569-41558591 CACCCCTCCTGGCCTGCTCTTGG + Intronic
906543706 1:46607081-46607103 CACCACGCCTGGCCTGGCATTGG - Intronic
907554863 1:55334931-55334953 CACCCCACCGTGCCTGTCATTGG + Intergenic
908475445 1:64483548-64483570 CACCCAGCCCAGCCTGCCCTTGG - Intronic
908821144 1:68087756-68087778 CACCCGCCGGGGCCTGTCATGGG - Intergenic
911039036 1:93577958-93577980 CACACCGCAGGGCCTGCATTAGG + Intronic
911051380 1:93674630-93674652 CGCCGTGCCGGTCCTGCCATGGG + Exonic
911128462 1:94364429-94364451 CACACCCCAGGGCCTGTCATGGG - Intergenic
911400092 1:97363783-97363805 CACACCCCAGGGCCTGTCATGGG + Intronic
913192682 1:116426641-116426663 GACCCAGCCTGGCATGCCATAGG - Intergenic
913272205 1:117105427-117105449 CACTGCGCTGGGCCTGCAATGGG - Exonic
914006490 1:143736645-143736667 CACCCCGCGGGGCGTGCAACTGG + Intergenic
915331050 1:155112524-155112546 CACCCCGCCCGGCCTGCAGCGGG - Intergenic
915393498 1:155564203-155564225 CACCGCGCCCGGCCTTGCATGGG - Intergenic
917763988 1:178197859-178197881 CACACAGCGGGGCCTGTCATTGG - Intronic
918070013 1:181127883-181127905 CACCGCGCCTGGCCTGCCTGTGG + Intergenic
918070158 1:181128683-181128705 CCCCCTGCCCGGCCTGCCCTGGG - Intergenic
919672168 1:200347805-200347827 CACCACGCCTGGCCTAACATTGG - Intergenic
920050327 1:203160955-203160977 CACCCTGGCAGGGCTGCCATAGG - Intronic
920275098 1:204798693-204798715 CAGCCAGCAGGGCCTGCCAGAGG + Intergenic
920315007 1:205070706-205070728 CACCGCGCCTGGCCTGCCATGGG - Intronic
921004701 1:211081799-211081821 CACACCCCGGGGCCTGTCATGGG + Intronic
921945176 1:220881212-220881234 CACCCCGGCGGGCCGCCCACCGG - Exonic
922335809 1:224617407-224617429 CATCCCGCCGGGCGCGCCTTCGG + Intronic
922385105 1:225074285-225074307 CACCGCGCCCGGCCTGTCTTAGG + Intronic
922527604 1:226317926-226317948 CACCGCGCCCGGCCGGCCATGGG + Intergenic
922762318 1:228140695-228140717 CACCGCGCCGGGCCAGCGGTAGG - Intronic
924201069 1:241659069-241659091 CACCCAGTGGGGCCTGTCATAGG - Intronic
924571567 1:245241708-245241730 CAGCCAGCTGGGGCTGCCATGGG - Intronic
924791872 1:247258177-247258199 CACCACGCCTGGCCTTCCATAGG + Intergenic
1063616367 10:7603869-7603891 CACCACGCCCGGCCTGATATGGG + Intronic
1064698575 10:17993174-17993196 CATCCAGCAGGGCCTGTCATTGG + Exonic
1064786512 10:18903138-18903160 CACCGCGCCCGGCCTGGCATGGG + Intergenic
1065426369 10:25608538-25608560 CACACACCCGGGCCTGTCATGGG - Intergenic
1066653620 10:37680884-37680906 CGCCCCGCGGGGCCTGCCGTCGG - Intergenic
1067078148 10:43199646-43199668 CACCCCACCATGTCTGCCATGGG + Intronic
1067469971 10:46528894-46528916 CCCTCCGTGGGGCCTGCCATGGG + Intergenic
1068356792 10:55920322-55920344 CACACATCCGGGCCTGTCATGGG - Intergenic
1069929562 10:71873428-71873450 CACCACGCCCGGCCTGAGATAGG + Intergenic
1070163737 10:73882056-73882078 CACCATGCCCGGCCTGACATGGG - Intergenic
1070476943 10:76838167-76838189 CACACCCCAGGGCCTGTCATGGG + Intergenic
1071511496 10:86265140-86265162 CACCCTGCCCGGCCCCCCATAGG + Intronic
1072571673 10:96663339-96663361 CACCGCGCCCAGCCTGCCATTGG - Intronic
1073824440 10:107304312-107304334 CACCACGCCTGGCCTGCCATTGG - Intergenic
1073912098 10:108357971-108357993 CACCGCGCCTGGCCTGACTTTGG + Intergenic
1074130385 10:110568160-110568182 CACCCCGCCGGGGCGGCCGCGGG + Intronic
1076401291 10:130187068-130187090 CACCCCGCTGGGCATGCTGTGGG + Intergenic
1076601845 10:131662319-131662341 CACCCACCGGGGCCTGTCATGGG + Intergenic
1077184009 11:1228471-1228493 TTCCCGGCCTGGCCTGCCATGGG + Intronic
1077504705 11:2924602-2924624 CGCCCTGCCAGGCCTGCCAAGGG - Intronic
1080744490 11:35096606-35096628 CACACCCCGGGGCCTGTCATGGG + Intergenic
1082068701 11:47921250-47921272 CACCACGCCCGGCCTGCCACTGG + Intergenic
1082247406 11:49940802-49940824 CACACCCCAGGGCCTGTCATGGG - Intergenic
1083798034 11:65029442-65029464 CACCACACCCGGCCTCCCATTGG + Intronic
1083951802 11:65960692-65960714 CACCGCGCCCGGCCTGCACTGGG + Intergenic
1084489722 11:69471733-69471755 CACCCTCCCGGGCCTACGATTGG - Intergenic
1084900892 11:72309022-72309044 CATCCCCAAGGGCCTGCCATGGG - Intronic
1085281278 11:75332606-75332628 CACCGCGCCTGGCCAGCTATAGG - Intronic
1085281507 11:75334041-75334063 CACCGCGCCCGGCCTGGGATGGG - Intronic
1089944009 11:122448529-122448551 CACACCCCGGGGCCTGTCATGGG + Intergenic
1090723529 11:129499468-129499490 CACACACCCGGGCCTGTCATGGG + Intergenic
1091567941 12:1662005-1662027 CACCCCGCGGGCCATGCCAGCGG + Intergenic
1091900228 12:4138548-4138570 CACACACCAGGGCCTGCCATGGG - Intergenic
1092254463 12:6918691-6918713 CACCGCGCCCGGCCTTCCAGTGG - Intronic
1096406020 12:51344834-51344856 CACAGCGCCTGGCCTCCCATTGG - Intronic
1099219673 12:79898159-79898181 CACCGCGCCCGGCCAGCTATTGG - Intronic
1100237164 12:92672510-92672532 CACCACGCCTGGCCTGCCACAGG - Intergenic
1102731360 12:115113753-115113775 CACACACCCGGGCCTGTCATGGG + Intergenic
1103314611 12:120042514-120042536 CACCACGCCCGGCCTGACTTAGG - Intronic
1103540647 12:121664094-121664116 CACCCACCCGGGCCTGCAAGGGG + Intronic
1104939315 12:132387455-132387477 CACGCCCCAGGGCCTGCAATGGG + Intergenic
1105000368 12:132686900-132686922 CACCCCGCAGGGCCTGGCCCGGG + Intronic
1105030451 12:132879281-132879303 CACCGCACCTGGCCTGCGATAGG + Intronic
1105423447 13:20273047-20273069 CACCCAGCCGGGCCTGCTGAAGG + Intergenic
1106649902 13:31679082-31679104 CACACACCCGGGCCTGTCATGGG - Intergenic
1107467864 13:40666032-40666054 CGCCGCGGCGGGCCTGCCCTCGG - Exonic
1108402296 13:50058468-50058490 CACCATGCCAGGCCTGTCATGGG + Intergenic
1108804259 13:54134444-54134466 CACACACCCGGGCCTGTCATGGG + Intergenic
1112200926 13:97273770-97273792 CACCGCGTCCGGCCTGCAATAGG - Intronic
1113454813 13:110440769-110440791 GAGCCTGCCGGGCCTGCCGTAGG - Intronic
1114461923 14:22891925-22891947 CACCGCGCCTGGCCTACCTTTGG + Intergenic
1116257972 14:42581945-42581967 CACCGCGCCCGGCCTGTAATAGG + Intergenic
1119223845 14:72929122-72929144 CACCCCGCCCGGCCTCCTCTGGG + Intronic
1119455064 14:74748119-74748141 CACCACGCCCCACCTGCCATTGG - Intergenic
1119740947 14:77013418-77013440 CACCGCGCCCGGCCTACCACAGG - Intergenic
1120161568 14:81151079-81151101 CACCCCGCCCAGCCTGTAATGGG + Intergenic
1120652834 14:87155201-87155223 CACCGTGCCCGGCCTGCCTTAGG - Intergenic
1121000816 14:90451082-90451104 CACCCCACCCAGCCTGCCAGAGG - Intergenic
1121701904 14:95961093-95961115 CACCCACCCGGGCCTCCCAAAGG - Intergenic
1121873921 14:97433881-97433903 CACCGCGCCAGGCCTCCAATTGG + Intergenic
1122217508 14:100214041-100214063 GACCCCGCAGAGCCTGCCAAGGG + Intergenic
1122222901 14:100252747-100252769 CACCATGCCTGGCCTGCAATGGG - Intronic
1122397417 14:101443250-101443272 CACCACGCCGGGCCTTCCCTAGG - Intergenic
1122836527 14:104433480-104433502 CAGCCAGTCGGGCCAGCCATGGG + Intergenic
1122902303 14:104786935-104786957 CTCCCCGCCAGGCCTGCCCAGGG + Intronic
1123035337 14:105469654-105469676 CACACCGCTGGGCCTGGCACAGG - Intronic
1123041816 14:105493340-105493362 CACCCCGTCGGGCCTGGCCTTGG + Intronic
1123781774 15:23635566-23635588 CACCGCGCCCGGCCTCCCTTGGG - Intergenic
1124884028 15:33667773-33667795 CACCGCGCCGGGCCTGACTCAGG - Intronic
1124914363 15:33954633-33954655 CACACCCCAGGGCCTGTCATGGG + Intronic
1125513992 15:40307893-40307915 CCACCCGCCCTGCCTGCCATGGG + Exonic
1126662307 15:51045210-51045232 CACCCTGCCTGGCCGGCTATAGG - Intergenic
1127679388 15:61278028-61278050 CACCGCGCCCGGCTTACCATTGG + Intergenic
1128582858 15:68820986-68821008 CCCCCCGCCGCCACTGCCATTGG - Intronic
1130722714 15:86405221-86405243 CACCGCGCCCGGCCAGGCATAGG - Intronic
1132573201 16:652975-652997 CACCCAGCAGGGCCTGACAAGGG - Intronic
1132745788 16:1435812-1435834 CACCCCGCCTGGCCTCCGACAGG + Intronic
1133980092 16:10626762-10626784 CACCACACCTGGCCTCCCATAGG + Intergenic
1134441558 16:14302185-14302207 CCCCGCCCCGGGCCGGCCATAGG + Intergenic
1134882440 16:17757472-17757494 CACCTCGCCTGGCCAGCCTTTGG + Intergenic
1135152221 16:20018704-20018726 CACACCCCAGGGCCTGTCATGGG + Intergenic
1135794114 16:25424968-25424990 CACCGTGCCCGGCCTGGCATGGG + Intergenic
1135922357 16:26662628-26662650 CACCACGCCTGGCCTGTCATTGG + Intergenic
1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG + Intronic
1138571101 16:57873755-57873777 CACCACGTCTGGCCTGCCAGTGG - Intergenic
1139871937 16:70114711-70114733 CACCCCGGCCGCCCTGGCATCGG - Intronic
1139950155 16:70664581-70664603 CAGCCCCGCGGGCCTGCCTTGGG + Exonic
1140303334 16:73779522-73779544 TACCCTGCCGTGTCTGCCATGGG + Intergenic
1140363987 16:74367772-74367794 CACCCCGGCCGCCCTGGCATCGG + Intergenic
1141621584 16:85239218-85239240 CACCACGCCAGGCCTGGCAGTGG + Intergenic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1142122416 16:88393469-88393491 CACCCAGGGGGGCCTGCCGTAGG + Intergenic
1142201769 16:88764462-88764484 CACCGCGCCCGGCCTGGCAGGGG - Intronic
1142231112 16:88900732-88900754 CACCCCGCCGGCCCAGCAACTGG + Intronic
1142746905 17:1964012-1964034 CACCGCGCCGGGCCTGCCCTTGG + Intronic
1143996326 17:11009641-11009663 CACCGCGCCCGGCCGGCCTTAGG - Intergenic
1144700947 17:17339013-17339035 CACCGCACCTGGCCTGTCATTGG + Intronic
1145265907 17:21379518-21379540 CCCCTCCCCGGGCCTGCCCTTGG + Intronic
1145761402 17:27427182-27427204 CACACAGCAGGGCCTGTCATGGG - Intergenic
1146208079 17:30921997-30922019 GAGCCCGCCGGGCCGGCCATGGG + Exonic
1147531402 17:41281587-41281609 CACACCCCAGGGCCTGTCATGGG + Intergenic
1147590961 17:41683027-41683049 CGCCACGCCCGGCCTGACATGGG - Intergenic
1148291857 17:46458827-46458849 CACCGTGCCCGGCCTCCCATGGG + Intergenic
1148314047 17:46676518-46676540 CACCATGCCCGGCCTCCCATGGG + Intronic
1148601703 17:48899225-48899247 CACCGCGCCTGGCCCGCCACAGG - Intergenic
1148807918 17:50273462-50273484 CGCCCCGGCGGGCCTGGCAGAGG + Intronic
1149156255 17:53633137-53633159 CACCGCGCCCGGCCTACCAGTGG + Intergenic
1149240678 17:54645173-54645195 CACACCCCAGGGCCTGTCATGGG + Intergenic
1149519493 17:57307725-57307747 CACCGTGCCTGGCCTGCCCTAGG + Intronic
1149637233 17:58180766-58180788 CACCCCTCCACGCCTGCCACAGG - Intergenic
1150226854 17:63529121-63529143 CACCACGCCCGGCCAGGCATGGG + Intronic
1150251130 17:63705054-63705076 CACCCAGCCTGGCCTCCCCTTGG - Intronic
1150255740 17:63742639-63742661 CACCGCGCCCGGCCTTCCAGGGG - Intronic
1151113511 17:71706244-71706266 CACACCTCGGGGCCTGTCATGGG - Intergenic
1151143136 17:72014651-72014673 CACACCCCAGGGCCTGTCATGGG + Intergenic
1151517531 17:74606067-74606089 CACCCAGCCAGGCCTGCCTTTGG - Intergenic
1152332735 17:79682609-79682631 CACCCCGCCTGGCCTTGAATAGG - Intergenic
1152673341 17:81622904-81622926 CACCACGCCTGGCCTGGAATTGG - Intronic
1154070821 18:11149735-11149757 GACCCGGCCTGGCCTGCCAGTGG + Intergenic
1154370028 18:13751951-13751973 CACACCGGGGGGCCTGTCATGGG + Intronic
1160700773 19:506315-506337 CACCGCGCCCGGCCTACCACAGG + Intergenic
1160876109 19:1296852-1296874 CACCCAGCCTGGCCCACCATGGG - Intronic
1160892979 19:1388833-1388855 CACCCAGCCTGCCCTGCCAAAGG + Exonic
1161161668 19:2765145-2765167 CACCCGGCCGCCCCTGCCCTGGG + Intronic
1162060305 19:8090770-8090792 CACCGCCCCTGGCCTGCCCTGGG + Intronic
1162445932 19:10722629-10722651 CACCGCGCCTGGCCTGAGATAGG + Intronic
1163495331 19:17643298-17643320 CACCGCGCCCGGCCAGCCATGGG + Intronic
1163699594 19:18780670-18780692 CACCCGGCCTGGCCCCCCATGGG - Exonic
1163818870 19:19484819-19484841 CACCGCGCCCAGCCTGTCATAGG + Intronic
1164423255 19:28116370-28116392 CACACACCCGGGCCTGTCATGGG - Intergenic
1164587727 19:29487119-29487141 CACCGCGCCTGGCCTTGCATGGG - Intergenic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1165191707 19:34069095-34069117 CACCGCGCCCGGCCTGTAATTGG + Intergenic
1165752624 19:38269895-38269917 CACCGCGCCCGGCCTGAGATGGG + Intronic
1166088003 19:40489674-40489696 CACTACGCCGGGGCGGCCATGGG + Intronic
1167440592 19:49506570-49506592 CACCGTGCCCGGCCTGCAATTGG + Intergenic
1167637982 19:50666519-50666541 CCCCCCGCCACGCCTGCCGTGGG + Exonic
1168419738 19:56193672-56193694 CACCGCGCCCGGCCTCTCATAGG - Intronic
1168678906 19:58299479-58299501 CACCGCGCCTGGCCTGACACGGG - Exonic
924968555 2:101199-101221 CGCACCCCCGGGCCTGCCAGGGG - Intergenic
926330444 2:11821226-11821248 CACCGTGCCTGGCCTGCCAGAGG - Intronic
927558204 2:24050313-24050335 TCCCCCGCCGGGCCTCCCCTCGG + Intronic
928241492 2:29590781-29590803 CACCGCGCCCGGCCTGCAGTGGG - Intronic
929848869 2:45562518-45562540 CACCGCGCCCGGCCTGTCACTGG + Intronic
929851798 2:45598324-45598346 CACCACGCCTGGCCTGTCACTGG - Intronic
930204730 2:48576765-48576787 CACCGCGCCCGGCCTGCAAACGG - Intronic
932467176 2:71931414-71931436 CACCGCGCCTGGCCTGCCACTGG + Intergenic
936591945 2:113812748-113812770 CACCCTGCCCGGCCTCCCCTAGG - Intergenic
937040329 2:118815821-118815843 CACACCTCTGGGCCTGCCAGAGG - Intergenic
938023761 2:127927098-127927120 CACCGCTCCGGGCCTGCCTCTGG - Intergenic
943624107 2:190180348-190180370 TCCCCCGCGGGGCCTGCCTTGGG - Intronic
944152077 2:196570533-196570555 CACACCCCGGGGCCTGTCATGGG + Intronic
945099422 2:206250657-206250679 CACCGCGCCCGGCCTGTCTTGGG + Intergenic
945417743 2:209595936-209595958 CACACCTCAGGGCCTGTCATGGG + Intronic
946513158 2:220382376-220382398 CACACACCCGGGCCTGCCATGGG - Intergenic
946925497 2:224622817-224622839 CACACAGCAGGGCCTGTCATGGG + Intergenic
947707334 2:232286931-232286953 CACCGCGCCTGGCCTGTCATTGG + Intronic
948052182 2:234987058-234987080 CACCCCGCCCGGCCTGCTAATGG + Intronic
948270512 2:236670009-236670031 CTCCCTGCTGGGGCTGCCATTGG + Intergenic
1170619872 20:17986647-17986669 CATCACACCTGGCCTGCCATTGG + Intronic
1170879609 20:20284571-20284593 CACCGCGCCCGGCCTTCAATTGG + Intronic
1170888979 20:20363763-20363785 CACCCCGCCTCGCCTGCCGCAGG - Intergenic
1173501566 20:43557965-43557987 CACCGCGCCTGGCCGGCCCTGGG - Intronic
1173816628 20:45993509-45993531 CACCCCAGCGGGCATGCCTTCGG - Intergenic
1174214242 20:48903943-48903965 CACCGCGCCTGACCTGCCCTAGG - Intergenic
1174607082 20:51768622-51768644 CGCCGCGCCGCGCCTGCCACGGG + Exonic
1175964525 20:62653871-62653893 CACACCCCGGGGCCTGCCATGGG + Intronic
1176006606 20:62867799-62867821 CACCGCGCCCGGCCAGCCTTTGG - Intergenic
1176101301 20:63365726-63365748 CTCCCTGCCAGCCCTGCCATGGG + Intronic
1178605798 21:34035682-34035704 CATCCAGCCAGGCCTGGCATGGG - Intergenic
1178858857 21:36272694-36272716 CACCGCGCCCGGCCTGAGATGGG - Intronic
1179354747 21:40648972-40648994 CTCAGCCCCGGGCCTGCCATTGG - Intronic
1180215758 21:46323161-46323183 CACCCCGGCGGTCCCGCCACAGG + Exonic
1181670379 22:24423212-24423234 CACCGCGCCCGGCCGGCAATGGG + Intronic
1182724060 22:32428420-32428442 CACCCTGCCCGGCCTCTCATGGG + Intronic
1182954081 22:34404591-34404613 CACCCACCGGGGCCTGTCATGGG + Intergenic
1183522220 22:38302206-38302228 CACCACGTCTGGCCTGCCCTGGG - Intronic
1183626779 22:39008784-39008806 CACTGCGCCGGGCTGGCCATTGG - Intergenic
1183730175 22:39614134-39614156 CACCATGCTGGGCCTGACATGGG + Intronic
1184111075 22:42395592-42395614 CACCGCGCCTGGCCTTCCTTTGG - Intronic
1184329846 22:43820489-43820511 CTGCCGGCCGGGCCTGTCATCGG + Intergenic
1185233787 22:49699590-49699612 CACCCCGCTGAGCCTGGCCTGGG - Intergenic
951558760 3:23945684-23945706 CACCCCGCCCCACCGGCCATGGG - Intronic
952996585 3:38889135-38889157 CACCGTGCCTGGCCTGCAATAGG - Intronic
955979022 3:64506081-64506103 CACCCATCAGGGCCTGTCATGGG + Intergenic
957997563 3:87709670-87709692 CACACAGCAGGGCCTGTCATGGG + Intergenic
958030317 3:88100791-88100813 CACACAGCGGGGCCTGTCATGGG + Intronic
959548571 3:107626938-107626960 CACCGCACCTGGCCTTCCATAGG + Intronic
959951870 3:112188395-112188417 CACCCACCAGGGCCTGTCATGGG - Intronic
960212566 3:114988260-114988282 CACACCCCGGGGCCTGTCATGGG - Intronic
960276223 3:115732318-115732340 CACACCCCAGGGCCTGTCATGGG - Intergenic
960687096 3:120306059-120306081 CACCGCGCCTGGCCTGCTTTGGG - Intergenic
962287127 3:134095949-134095971 CACACACCCGGGCCTGTCATGGG - Intronic
963164166 3:142183885-142183907 CACCATGCCCGGCCTGCCTTAGG + Intronic
963451146 3:145482900-145482922 CCCCCCGCCCGGCCAGCCAGGGG + Intergenic
966285716 3:178293397-178293419 CACCTCGCAGGGCGTGCAATGGG + Intergenic
968751332 4:2390824-2390846 CACACTGCCAGGCCAGCCATAGG - Intronic
968944848 4:3658284-3658306 CACCCGGCTGGGCCTGGCAGAGG + Intergenic
969569402 4:7999856-7999878 CACCCCGCCAGGCCTGCTCTTGG + Intronic
969600114 4:8171249-8171271 CACCACGCCCGGCCTGCAAGTGG + Intergenic
969972275 4:11060257-11060279 CACCACGCCTGGCCTACTATTGG + Intergenic
970218601 4:13784725-13784747 CACCGCGCCCGGCCTGCTTTTGG - Intergenic
970304227 4:14715027-14715049 CACACACCCGGGCCTGTCATGGG + Intergenic
971586817 4:28414920-28414942 CACCGCGCCCGGCCTACCAGTGG + Intergenic
972643436 4:40945942-40945964 CACCACGCCCGGCCTTCCTTGGG - Intronic
972970859 4:44574656-44574678 CACCGCGCCCGGCCTGGAATTGG + Intergenic
973563996 4:52165374-52165396 CACCCACCAGGGCCTGTCATGGG - Intergenic
974162288 4:58155551-58155573 CACACACCCGGGCCTGTCATGGG + Intergenic
976180140 4:82391087-82391109 CACCGCGCCCGGCCAGCCTTTGG + Intergenic
976568152 4:86576484-86576506 CACCGCGCCCGGCCTACTATAGG - Intronic
979269962 4:118747975-118747997 CACCACGCCCGGCCTACTATAGG - Intronic
980144820 4:128969282-128969304 CACCGCGCCCGGCCAGCAATAGG - Intronic
980244029 4:130214485-130214507 CTCCCCTCCAGGCCTGCCAGTGG - Intergenic
980329385 4:131390564-131390586 CACCGCGCCTGGCCTAGCATAGG + Intergenic
980329439 4:131390893-131390915 CACCACGCCTGGCCTAGCATAGG + Intergenic
981152809 4:141398642-141398664 CACACCCCGGGGCCTGTCATGGG - Intergenic
982354477 4:154451208-154451230 CACCTAGCTGGGCCTGCCAAAGG - Intronic
985772419 5:1821159-1821181 GTCCCCGCCAGGCCAGCCATGGG - Intergenic
987178921 5:15346133-15346155 CACCGCGCCCGGCCTCCGATAGG - Intergenic
987317159 5:16734514-16734536 CACCATGCCCGGCCTGACATCGG - Intronic
987897923 5:23972455-23972477 CACCACGCCTGGCCTGAAATAGG - Intronic
991435771 5:66596278-66596300 CAGCGCGCCTGCCCTGCCATTGG + Intergenic
995052244 5:107719719-107719741 CACCACGCAGGGCCTCCCTTTGG + Intergenic
995851447 5:116550448-116550470 CAGCCCTCAGAGCCTGCCATGGG - Intronic
995894326 5:116994852-116994874 CACACTTCAGGGCCTGCCATGGG + Intergenic
996269630 5:121587655-121587677 CACCGCGCCCGGCCTGTCACAGG - Intergenic
996923369 5:128794803-128794825 CACACACCAGGGCCTGCCATGGG - Intronic
997306905 5:132844367-132844389 CACCACACCCGGCCTGACATTGG + Intergenic
998143780 5:139714105-139714127 CACCGCGCCCGGCCTGGCATGGG + Intergenic
998782566 5:145674320-145674342 CACACACCCGGGCCTGTCATGGG - Intronic
999109698 5:149108038-149108060 CACACACCAGGGCCTGCCATGGG + Intergenic
1000391249 5:160725731-160725753 CACCACGCCCGGCCTACTATGGG + Intronic
1001525200 5:172423929-172423951 CACCGCGCCCGGCCCGCCCTGGG + Intronic
1002607826 5:180393786-180393808 CCACCCCCCGTGCCTGCCATGGG - Intergenic
1004282164 6:14289500-14289522 CACACCCCAGGGCCTGTCATGGG + Intergenic
1005752291 6:28894711-28894733 CACCACTCCGGGCCTACCATAGG + Intergenic
1006484749 6:34329809-34329831 CACACACCAGGGCCTGCCATGGG - Intronic
1007958096 6:45935281-45935303 CACCCCTCCCCGCCTGCCACTGG - Intronic
1011063732 6:83301027-83301049 CACACACCAGGGCCTGCCATGGG + Intronic
1011433039 6:87308207-87308229 CACCCACCGGGGCCTGACATGGG + Intronic
1014462146 6:121708906-121708928 CACACACCCGGGCCTGTCATGGG + Intergenic
1016577236 6:145583571-145583593 CACCCCACCCCGCCCGCCATTGG - Intronic
1016957615 6:149641462-149641484 CACAGCGCCTGGCCTGCCTTGGG + Intronic
1017873079 6:158502707-158502729 CACCCCCCCGGGCCCGCCCTTGG - Exonic
1019149141 6:169992868-169992890 CACCCGGCCAGGCGGGCCATGGG + Intergenic
1019726416 7:2605330-2605352 CACCGCGCCCGGCCTACTATAGG - Intronic
1019816627 7:3205801-3205823 CACCACGCCTGGCCTGGCCTGGG - Intergenic
1020382985 7:7566762-7566784 CACCCCGCAGGCCCTGCCCGTGG - Intergenic
1020656781 7:10937569-10937591 CACCGTGCCTGGCCTGCCCTTGG + Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1021375375 7:19900710-19900732 CACACACCAGGGCCTGCCATGGG - Intergenic
1023846527 7:44123874-44123896 CACCCCGCCAGACCTCCCAGTGG + Intronic
1024822364 7:53347892-53347914 CACACCCCAGGGCCTGTCATGGG + Intergenic
1025067058 7:55866288-55866310 CACCGCGCCCGGCCAGGCATTGG - Intergenic
1025743340 7:64220800-64220822 CACCACACCTGGCCTGCCAGTGG + Intronic
1025855491 7:65273339-65273361 CACCACGCCCGGCCGGTCATGGG + Intergenic
1025899074 7:65729289-65729311 CACCGTGCCTGGCCTTCCATCGG - Intergenic
1025900768 7:65742729-65742751 CACCGCGCCCAGCCTCCCATGGG + Intergenic
1026870306 7:73847027-73847049 CACCACACCTGGCCTGCCTTGGG - Intergenic
1027213978 7:76172466-76172488 CACCAAGCCCGGCCTGGCATGGG - Intergenic
1029518520 7:101044000-101044022 CACACACCGGGGCCTGCCATGGG - Intronic
1029869626 7:103676870-103676892 CACACAGCGGGGCCTGTCATGGG + Intronic
1030311468 7:108073292-108073314 CACCGCGCCCGGCCAGCTATAGG + Intronic
1031935333 7:127730253-127730275 CACCGCGCCCAGCCTGACATTGG + Intronic
1036184412 8:6611904-6611926 CACCGCGCCCGGCCTGACGTCGG + Intronic
1036218006 8:6896869-6896891 CACCCAGCCTGGCCTTCCACGGG - Intergenic
1036780144 8:11641198-11641220 CACTCCGCCCGGCCTGCCTGGGG - Intergenic
1039698997 8:39943447-39943469 CACCGCGCCCGGCCAGCTATAGG - Intronic
1039830918 8:41213716-41213738 CACCCCCCCGGGCCTGTCGGGGG + Intergenic
1041794991 8:61737662-61737684 CACCACGCCTGGCCAGTCATAGG + Intergenic
1043036876 8:75210001-75210023 CACCACGCCTGGCCTAACATTGG - Intergenic
1043173928 8:77000446-77000468 CACCCGGCGGCGCCTGCCAGAGG - Intronic
1043699796 8:83271205-83271227 CACACACCCGGGCCTGTCATGGG + Intergenic
1045630310 8:104111692-104111714 CACCGCACCCGGCCTCCCATTGG + Intronic
1046249506 8:111611760-111611782 CTCCCCGCCTGGCTTGCCCTCGG - Intergenic
1047273794 8:123389349-123389371 CACCACGCCCGGCCGACCATTGG - Intronic
1047293642 8:123551918-123551940 CACACCCCAGGGCCTGTCATGGG + Intergenic
1048183873 8:132220976-132220998 CACACCCCGGGGCCTGTCATGGG - Intronic
1048792053 8:138113158-138113180 CACCCCTCCGGGAATCCCATGGG + Intergenic
1049233959 8:141499769-141499791 CACCGCGCCCGGCCTGCTTTTGG - Intergenic
1049401317 8:142428763-142428785 CCCCCCGCCCGTCCTGCCAGTGG + Intergenic
1049761301 8:144333029-144333051 CACCCCGCCCCGCCCGCCAGGGG - Exonic
1049998686 9:1053255-1053277 CACCCTGCCTGCCCTGCCACAGG + Intronic
1050276629 9:4007864-4007886 ACCCCCGCCCGACCTGCCATGGG - Intronic
1050347846 9:4710505-4710527 CACCGCGCCCGGCCTCTCATTGG + Intronic
1051480244 9:17551879-17551901 CACCACGCCTGGCCAGCAATTGG - Intergenic
1052195799 9:25713472-25713494 CACCGCGCCCGGCCCTCCATGGG - Intergenic
1053363217 9:37504272-37504294 CACACTGCCGGGGTTGCCATCGG + Intergenic
1053476525 9:38385849-38385871 CACACGGCAGGGCCTGGCATAGG + Intergenic
1055131979 9:72786155-72786177 CACCGCGCCTGGCCTGCCTAAGG - Intronic
1056456485 9:86765938-86765960 CACCCCGCCCGGCCTGGAGTGGG + Intergenic
1056962106 9:91134420-91134442 CACCGCGCCCGGCCTGCTGTTGG + Intergenic
1057190989 9:93087636-93087658 CACCCCGCCTGGCCTTTCCTTGG + Intergenic
1057914164 9:99043073-99043095 CAACCCCCTGAGCCTGCCATGGG + Intronic
1059226246 9:112675672-112675694 CACCGCGTCCGGCCGGCCATTGG + Intergenic
1186071219 X:5822733-5822755 CACCACGCCCGGCCTGCCTTTGG + Intergenic
1186506558 X:10097974-10097996 CACCGCGCCTGGCTTGCCCTTGG + Intronic
1188054204 X:25522668-25522690 CTCCGCGCCCGGCCTGCCTTTGG + Intergenic
1189391751 X:40582137-40582159 CACCGCGCCCGGCCTCCCATAGG - Intronic
1190609170 X:52176748-52176770 CACACAGCGGGGCCTGTCATGGG + Intergenic
1190873734 X:54445558-54445580 CTGCCCGCTGGCCCTGCCATGGG + Exonic
1192199281 X:69054870-69054892 CACACCCCGGGGCCTGTCATGGG + Intergenic
1194597583 X:95877804-95877826 CACCGCGCCTGGCCAGCAATTGG + Intergenic
1196272772 X:113731885-113731907 CACCGCGCCCGGCCTGACAATGG + Intergenic
1198082951 X:133256232-133256254 CAACCTTCCGGCCCTGCCATCGG + Intergenic
1198587830 X:138142343-138142365 CACACCCCGGGGCCTGTCATGGG - Intergenic
1198617967 X:138479400-138479422 CACACCCCGGGGCCTGTCATGGG - Intergenic
1199459421 X:148068480-148068502 CACACACCAGGGCCTGCCATGGG - Intergenic
1200171585 X:154079903-154079925 CACCACGCTGGGCCTGCTGTTGG - Intronic
1200292925 X:154888681-154888703 CACCACGCCTGGCCTGTAATAGG + Intronic
1200339773 X:155384413-155384435 CACCACGCCTGGCCTGTAATAGG + Intergenic
1200346697 X:155456275-155456297 CACCACGCCTGGCCTGTAATAGG - Intergenic