ID: 1137249039

View in Genome Browser
Species Human (GRCh38)
Location 16:46729687-46729709
Sequence CCGTGTGGCTATGTCTCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137249039_1137249046 18 Left 1137249039 16:46729687-46729709 CCTGCAGAGACATAGCCACACGG 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1137249046 16:46729728-46729750 GCTCATCCCACACCCATCCCTGG 0: 1
1: 0
2: 0
3: 34
4: 314
1137249039_1137249049 26 Left 1137249039 16:46729687-46729709 CCTGCAGAGACATAGCCACACGG 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1137249049 16:46729736-46729758 CACACCCATCCCTGGACTTCTGG 0: 1
1: 0
2: 7
3: 27
4: 250
1137249039_1137249043 -4 Left 1137249039 16:46729687-46729709 CCTGCAGAGACATAGCCACACGG 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1137249043 16:46729706-46729728 ACGGCAGGCTGAGAGCCCAGAGG 0: 1
1: 0
2: 1
3: 16
4: 263
1137249039_1137249050 27 Left 1137249039 16:46729687-46729709 CCTGCAGAGACATAGCCACACGG 0: 1
1: 0
2: 0
3: 14
4: 82
Right 1137249050 16:46729737-46729759 ACACCCATCCCTGGACTTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137249039 Original CRISPR CCGTGTGGCTATGTCTCTGC AGG (reversed) Exonic
900763325 1:4487386-4487408 CCGTGTGTCTGTGCCTTTGCAGG + Intergenic
900779174 1:4606402-4606424 CCATGTGGATGGGTCTCTGCTGG + Intergenic
910737318 1:90473898-90473920 CCTTGTGCCTATGTCTCAACTGG + Intergenic
911635814 1:100234733-100234755 CCTTATGGTTATGTCTCTGGTGG - Intronic
918468281 1:184843949-184843971 CTGTGTGGCTTACTCTCTGCAGG + Intronic
921159906 1:212465363-212465385 CCCAGTGGCCATGTCTCTGCAGG + Intergenic
924628543 1:245715652-245715674 CCTTTTGGCTATTTCTCTGGAGG + Intergenic
1066991301 10:42516731-42516753 AGTTGTGGCTATGTGTCTGCTGG - Intergenic
1069709999 10:70482072-70482094 CCCTGTGGCCAGGACTCTGCAGG + Intronic
1070738238 10:78880822-78880844 CCATGTGTCCATCTCTCTGCCGG - Intergenic
1071157863 10:82711895-82711917 GTGTGTGTCTATGTGTCTGCAGG - Intronic
1075926243 10:126253964-126253986 CCAGGGCGCTATGTCTCTGCCGG + Intronic
1076114895 10:127888375-127888397 CAGTGTGGTTATATCTCTGGGGG + Intronic
1077800072 11:5528214-5528236 CCATCTGGCTGTGTCCCTGCAGG + Intronic
1077808215 11:5610618-5610640 CTGTGTGGCTATGTCTGGGGAGG - Intronic
1078250532 11:9613436-9613458 ACGTGTCGCTCTGTCCCTGCGGG + Intergenic
1080835909 11:35940914-35940936 CCCTGTGGATATGTCTATGTGGG - Intergenic
1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG + Intergenic
1087796753 11:102462102-102462124 ATGTGTGGCCATGTCCCTGCAGG + Intronic
1091009557 11:131986229-131986251 CCCTAGGGATATGTCTCTGCTGG + Intronic
1092868684 12:12786887-12786909 CCGCGTGTCTATGTCCCCGCAGG + Exonic
1102539697 12:113609961-113609983 CCGTGTGTCTGTGTGTCTGTAGG + Intergenic
1108465490 13:50710944-50710966 TGGTTTGGCTGTGTCTCTGCTGG + Intronic
1115514756 14:34174188-34174210 TTGTGTGGCAATCTCTCTGCAGG + Intronic
1116867734 14:50044849-50044871 CTGTGTGTCTTTGTCTCTACGGG + Intergenic
1202926253 14_KI270724v1_random:28548-28570 CCCTGTGGCTGTGGCTCCGCCGG - Intergenic
1130801348 15:87266840-87266862 CTCTGTGGCTCTGCCTCTGCTGG - Intergenic
1133980388 16:10629039-10629061 CCGTATGGCTTTGCCTCTTCTGG - Intronic
1134115955 16:11549006-11549028 CCTTGTGGATATGTCTGTACTGG + Exonic
1135295094 16:21272557-21272579 GCCTGTGGCTGTGTCTCTGTAGG - Intronic
1136022475 16:27448945-27448967 TCCTGTGGCTGTGTCTCAGCTGG + Exonic
1137249039 16:46729687-46729709 CCGTGTGGCTATGTCTCTGCAGG - Exonic
1137772210 16:51025417-51025439 CCTGGTGGCTATGTCTGTGGTGG + Intergenic
1138219349 16:55237754-55237776 CAGATTGGCTGTGTCTCTGCTGG - Intergenic
1142279930 16:89142506-89142528 AGGTGTGGGTATGTCTCTGCAGG - Intronic
1142279942 16:89142580-89142602 AGGTGTGGCTGTGTCTCTGCAGG - Intronic
1142279960 16:89142708-89142730 AGGTGTGGCTGTGTCTCTGCAGG - Intronic
1142279965 16:89142746-89142768 AGGTGTGGGTGTGTCTCTGCAGG - Intronic
1143978036 17:10844686-10844708 CTGTGAGCCTAAGTCTCTGCTGG + Intergenic
1147317266 17:39626947-39626969 GCGTGTGTCTCTGCCTCTGCCGG - Exonic
1148864450 17:50621209-50621231 CCGTGCCGCTCTGTCTGTGCCGG + Intronic
1149299747 17:55294140-55294162 CAGTGTGGCTGTGTCCCTGAGGG + Intronic
1152775227 17:82197129-82197151 ACGAGGGGCTGTGTCTCTGCAGG - Intronic
1155776332 18:29766558-29766580 CCAGGTGGCGATGTTTCTGCTGG + Intergenic
1160528866 18:79552235-79552257 CTGTGTGTCTGTGTCTCTGTGGG + Intergenic
1161282247 19:3452401-3452423 CCGTGTGACTGTGTGTCTGTGGG - Intronic
1162003537 19:7763445-7763467 TCTTGTGGCCATGTATCTGCTGG - Exonic
1164534892 19:29077994-29078016 CTGTGTGACTATGGCTCAGCTGG + Intergenic
1164756271 19:30691980-30692002 CCGGGGGTCTTTGTCTCTGCAGG + Intronic
1165141173 19:33700796-33700818 CAGTGTGGGTGTGTCCCTGCTGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
925415997 2:3670568-3670590 CTCTGTGGCTCAGTCTCTGCTGG + Intronic
931795366 2:65703230-65703252 ATGTGTGGCTGTGTCTCTTCTGG + Intergenic
931997960 2:67857062-67857084 TCATGTGTCTTTGTCTCTGCAGG + Intergenic
935315621 2:101830864-101830886 CCGTGTGTCTCTGTCTCTAAAGG + Intronic
1170598825 20:17825326-17825348 TCCTGTGGCTCCGTCTCTGCTGG - Intergenic
1172006842 20:31823678-31823700 CCATGTGGCCATGTCTCAGCGGG - Intronic
1172876338 20:38166530-38166552 CCGTGGGCCTCTGTCTCTCCGGG - Intronic
1172974939 20:38899245-38899267 GCCTGTGCCTATGTCTCTGATGG + Intronic
1173063482 20:39684350-39684372 CCAAGTGGCTTTGTCTCTACTGG - Intergenic
1181520718 22:23448093-23448115 CCTTGTGGCTCTGTCTCGGCCGG + Intergenic
1183726095 22:39590440-39590462 CCGTCTGGCTGTGTCCCTGCTGG - Intronic
1184383824 22:44163057-44163079 ACGTGAGGCTGTGTCTCTGCAGG - Intronic
953223512 3:40996586-40996608 CCCTGAGGCAATGCCTCTGCAGG + Intergenic
953405868 3:42659473-42659495 CCGTGTGGCCATGTGACTGTGGG - Exonic
954363479 3:50134474-50134496 CCTTGTGGCTTTGTCTGGGCTGG - Intergenic
954665168 3:52247738-52247760 CCTGGTGGCTGTGTCCCTGCAGG + Exonic
962946580 3:140176541-140176563 CCAAGTGGGTGTGTCTCTGCAGG + Intronic
963256773 3:143152785-143152807 CCGTGTGGCATTGGCTCTGCTGG + Intergenic
966124384 3:176558699-176558721 CTGTGGGGCTCTGTTTCTGCAGG + Intergenic
967655116 3:192038803-192038825 CTGTGTGGCCATATCTCTGCGGG + Intergenic
985764933 5:1772378-1772400 GGGTGTGGCAATGGCTCTGCAGG - Intergenic
990168075 5:53017591-53017613 CCGTGTGCCCATGTGTCAGCTGG + Intronic
992351712 5:75936311-75936333 CCTTGGGTCTATGTCTCTACAGG + Intergenic
994621414 5:102167373-102167395 TCGAGTAGCTATGTTTCTGCAGG - Intergenic
1006299942 6:33188496-33188518 CCGTGTGGCTGTGGCTGTGAAGG - Exonic
1006444028 6:34068887-34068909 GGATGTGCCTATGTCTCTGCTGG - Intronic
1019590522 7:1828154-1828176 CCTTGTGGCTCTGTCTCGGCCGG - Intronic
1029688746 7:102166390-102166412 CCCAGTGGCCCTGTCTCTGCAGG + Intronic
1036454848 8:8897620-8897642 CCGTGTGGTTAAGTTTCTGATGG + Intergenic
1036643246 8:10597126-10597148 CAGGGTGCCTATGTCTCTGGAGG - Intergenic
1040311158 8:46237552-46237574 CAGTGTGACTATGTCTCTCGGGG + Intergenic
1040333774 8:46405775-46405797 CAGAGTGGCTATGTCTCCACGGG + Intergenic
1047992373 8:130299124-130299146 CCGTGTGTCCGTGCCTCTGCAGG + Intronic
1048173352 8:132129531-132129553 GCGTGATGCTACGTCTCTGCCGG + Exonic
1052489071 9:29139916-29139938 CTGTCTGTCTATGGCTCTGCAGG - Intergenic
1052879316 9:33591106-33591128 CCATGAGGCTCTGCCTCTGCAGG - Intergenic
1053496660 9:38553111-38553133 CCATGAGGCTCTGCCTCTGCAGG + Intronic
1057480831 9:95444480-95444502 GCGTGTGTGTGTGTCTCTGCTGG - Exonic
1057676574 9:97140671-97140693 CCATGAGGCTCTGCCTCTGCAGG + Intergenic
1057962013 9:99465874-99465896 CCTTGTGGATATGTCTCTGGTGG - Intergenic
1058531283 9:105907346-105907368 CCCTGTAGCTATATCTCTGCAGG + Intergenic
1058746784 9:107999355-107999377 CCGTGTGGCTGCATCTCTGCTGG - Intergenic
1061699845 9:132407589-132407611 CCTTTTGGCTAAGTCTCTTCAGG - Intergenic
1186834563 X:13424940-13424962 CCGTGTGTCTATTTCTTAGCTGG - Intergenic
1198126882 X:133653611-133653633 CCGGGTGGGGAGGTCTCTGCTGG - Intronic
1201252847 Y:12076946-12076968 CTGTATGGCTATGTCTCCTCAGG - Intergenic