ID: 1137259954

View in Genome Browser
Species Human (GRCh38)
Location 16:46818151-46818173
Sequence TAGGCATGAGTCACCGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124749
Summary {0: 1, 1: 56, 2: 1981, 3: 22910, 4: 99801}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137259948_1137259954 11 Left 1137259948 16:46818117-46818139 CCATCTGCCTCAGCCTCTCAAAG 0: 80
1: 2925
2: 33570
3: 90935
4: 170756
Right 1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG 0: 1
1: 56
2: 1981
3: 22910
4: 99801
1137259952_1137259954 -2 Left 1137259952 16:46818130-46818152 CCTCTCAAAGTGCTGGGATTATA 0: 1280
1: 39682
2: 334961
3: 254257
4: 135745
Right 1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG 0: 1
1: 56
2: 1981
3: 22910
4: 99801
1137259946_1137259954 27 Left 1137259946 16:46818101-46818123 CCTGACCTCAAGTGATCCATCTG 0: 447
1: 8809
2: 38204
3: 79491
4: 121025
Right 1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG 0: 1
1: 56
2: 1981
3: 22910
4: 99801
1137259950_1137259954 4 Left 1137259950 16:46818124-46818146 CCTCAGCCTCTCAAAGTGCTGGG 0: 3353
1: 93329
2: 214733
3: 240732
4: 266885
Right 1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG 0: 1
1: 56
2: 1981
3: 22910
4: 99801
1137259947_1137259954 22 Left 1137259947 16:46818106-46818128 CCTCAAGTGATCCATCTGCCTCA 0: 211
1: 3920
2: 18490
3: 46146
4: 78495
Right 1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG 0: 1
1: 56
2: 1981
3: 22910
4: 99801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137259954 Original CRISPR TAGGCATGAGTCACCGCCCC TGG Intronic
Too many off-targets to display for this crispr