ID: 1137261057

View in Genome Browser
Species Human (GRCh38)
Location 16:46830762-46830784
Sequence CAGACTCTCCTCGCCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137261057_1137261072 29 Left 1137261057 16:46830762-46830784 CCGCCGCCGGCGAGGAGAGTCTG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1137261072 16:46830814-46830836 CCAAAGGCGCGCTCCTCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 65
1137261057_1137261063 -2 Left 1137261057 16:46830762-46830784 CCGCCGCCGGCGAGGAGAGTCTG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1137261063 16:46830783-46830805 TGGGGCTCCAGACAGCCGCCCGG 0: 1
1: 0
2: 1
3: 16
4: 247
1137261057_1137261066 13 Left 1137261057 16:46830762-46830784 CCGCCGCCGGCGAGGAGAGTCTG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1137261066 16:46830798-46830820 CCGCCCGGTGAGCCCACCAAAGG 0: 1
1: 0
2: 0
3: 6
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137261057 Original CRISPR CAGACTCTCCTCGCCGGCGG CGG (reversed) Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
905175137 1:36130660-36130682 CAGCCTCTCCTCTCAGGCAGGGG + Intergenic
907494964 1:54837582-54837604 CAGACTCTCCTGCCCAGTGGTGG + Intronic
908195382 1:61742409-61742431 CCGACTCTCCCCGCCCGGGGCGG - Intergenic
911597448 1:99813419-99813441 AAAACTCTCCTCGCCGGGCGTGG + Intergenic
913047794 1:115089032-115089054 CAGCCTCTCCTCACCTCCGGAGG - Intronic
915447126 1:155980108-155980130 CAGACTCACCTCCCCTGAGGTGG + Intronic
1066080652 10:31928320-31928342 CACACTCTCCTCCCTGGGGGCGG + Intronic
1077364282 11:2155277-2155299 CAGGCTCTCCTCGCCCAGGGGGG - Intronic
1077503433 11:2919475-2919497 TAGAGGCTCCTCCCCGGCGGAGG + Intronic
1082928991 11:58579502-58579524 CCGAGTATCCCCGCCGGCGGAGG + Exonic
1089622051 11:119727938-119727960 CCGACTCTCCGCGCCCGCTGTGG + Intronic
1089796628 11:120986199-120986221 CAGGCTCTCCTCGCTGCGGGCGG - Exonic
1091474079 12:754097-754119 CTGCCACTTCTCGCCGGCGGCGG - Exonic
1091596016 12:1879627-1879649 CAGACTCTCCTGGTTGGAGGTGG - Intronic
1103377601 12:120469244-120469266 CAGCCTCTCCTCGCAGGCCCGGG - Intronic
1103789279 12:123458137-123458159 CAGATTCTCCGCGCCGGCCTCGG - Intronic
1113036250 13:106052850-106052872 CAAGCTCTCCACACCGGCGGGGG + Intergenic
1114523401 14:23352579-23352601 CAGACGCTCCGCGGGGGCGGGGG + Intronic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1123964043 15:25438364-25438386 AACACTCGCCTCGGCGGCGGGGG + Intronic
1128635315 15:69298968-69298990 CAGACACTCCTCCCGGGCTGCGG - Exonic
1128743295 15:70097408-70097430 CAGGCTCTCCTCTCCGAGGGGGG - Exonic
1131827134 15:96331005-96331027 AAGAGTCAACTCGCCGGCGGCGG - Exonic
1132239283 15:100245241-100245263 CAGAATCCCCTCGCAGGCAGGGG + Intronic
1132690905 16:1181403-1181425 CAGACTCTCCTGGCCGACGCGGG - Intronic
1135419668 16:22297444-22297466 CCGGCTCTCCTCTCAGGCGGCGG - Exonic
1137261057 16:46830762-46830784 CAGACTCTCCTCGCCGGCGGCGG - Intronic
1140091907 16:71845938-71845960 CAATCTCTCCGCGCCGGGGGCGG + Intergenic
1150060689 17:62065725-62065747 CAGAGTCTCCTCAGCGGCGGAGG + Intergenic
1152070868 17:78133004-78133026 CAGACTGGCCTGGCCGGTGGTGG + Intronic
1152868572 17:82738299-82738321 CAGCCTCTCGTCTCCGACGGGGG + Intronic
1161577788 19:5064446-5064468 CACACATTCCTCGGCGGCGGGGG + Intronic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
928143641 2:28752092-28752114 CAGACTCTCCTTCCCAGCAGCGG - Exonic
932852608 2:75200962-75200984 CAGATTCTCCTCCCCGGCGTGGG - Intergenic
948336674 2:237213872-237213894 CAGAGCCTCCTGGCCTGCGGAGG + Intergenic
1171486670 20:25490782-25490804 CAGCCTCTCCTCCCGGGAGGTGG + Intronic
1171848038 20:30289796-30289818 CCGCCTCTCTTCGCCGGCGCTGG - Intergenic
1175561486 20:59933937-59933959 GCGAGTCTCCTCGCTGGCGGGGG - Intronic
1181830449 22:25556373-25556395 CAGACACTCCTGGCCGGGTGTGG + Intergenic
1182485265 22:30635463-30635485 CAGCCTCTCTTCGCCGCCAGGGG - Intergenic
1185297088 22:50059724-50059746 CAGCCTCTCCTCTCCCACGGTGG + Exonic
962301896 3:134250666-134250688 CCGACGCTCCTCTTCGGCGGCGG - Exonic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
969582227 4:8072082-8072104 CAGACTCGCCTCCCCGGCAGAGG + Intronic
981044351 4:140252354-140252376 CCGACTCTCCTTGCAGGAGGAGG - Intergenic
993501867 5:88674665-88674687 CACACTCCCCTCGCAGGCGTGGG + Intergenic
999327078 5:150650149-150650171 CAGGCTGTCCTGGCCGGGGGAGG - Exonic
999726947 5:154445742-154445764 CAGACTCTCCGGCCCGGGGGAGG - Intergenic
1006610749 6:35292884-35292906 CGGACTCTCCTCGGCTGCAGAGG - Exonic
1008872891 6:56292399-56292421 CAGACTCTCTTTGGCGGGGGAGG - Intronic
1010980589 6:82364987-82365009 CAGACGCCCGTCCCCGGCGGCGG - Exonic
1018953510 6:168393440-168393462 CAGACACTCCTGGCAGGAGGTGG + Intergenic
1020084723 7:5304061-5304083 CAAACTCTGCTTGCAGGCGGCGG - Exonic
1022675486 7:32495461-32495483 CAGCCCTGCCTCGCCGGCGGCGG + Intronic
1025209584 7:57013139-57013161 CAAACTCTGCTTGCAGGCGGCGG + Intergenic
1025662367 7:63563711-63563733 CAAACTCTGCTTGCAGGCGGCGG - Intergenic
1035534537 8:381156-381178 CAGACTCTCCCCGTCAGCAGCGG + Intergenic
1035565211 8:636527-636549 CAGAGTCTCCTCACGGACGGAGG + Intronic
1036033146 8:4993754-4993776 CAGCTACTCCTCGCCGGCTGAGG + Intronic
1036562095 8:9906405-9906427 CAGAGTCCCCTCGGCGGCCGCGG + Intergenic
1037888052 8:22605239-22605261 CACAGTCTCCTCGCCGGCACCGG + Intronic
1038537115 8:28361129-28361151 CTGCCTCTCCTCTCCTGCGGAGG + Exonic
1049079567 8:140431164-140431186 CTGACCCTCCTCGCCGGGCGCGG + Intronic
1049561523 8:143314154-143314176 CAGACTCTTCTCCAGGGCGGCGG - Intronic
1062595957 9:137299351-137299373 CGAACTCTCCTCTCCAGCGGAGG + Intergenic