ID: 1137264038

View in Genome Browser
Species Human (GRCh38)
Location 16:46854112-46854134
Sequence TCACAGCTGCCATCTAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137264038_1137264042 3 Left 1137264038 16:46854112-46854134 CCGGCGCTAGATGGCAGCTGTGA No data
Right 1137264042 16:46854138-46854160 ACTGGTGTTGTTGCTCACTGAGG No data
1137264038_1137264045 29 Left 1137264038 16:46854112-46854134 CCGGCGCTAGATGGCAGCTGTGA No data
Right 1137264045 16:46854164-46854186 ATTAACAATTCCAGCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137264038 Original CRISPR TCACAGCTGCCATCTAGCGC CGG (reversed) Intergenic
No off target data available for this crispr