ID: 1137264042

View in Genome Browser
Species Human (GRCh38)
Location 16:46854138-46854160
Sequence ACTGGTGTTGTTGCTCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137264038_1137264042 3 Left 1137264038 16:46854112-46854134 CCGGCGCTAGATGGCAGCTGTGA No data
Right 1137264042 16:46854138-46854160 ACTGGTGTTGTTGCTCACTGAGG No data
1137264037_1137264042 10 Left 1137264037 16:46854105-46854127 CCGGCATCCGGCGCTAGATGGCA No data
Right 1137264042 16:46854138-46854160 ACTGGTGTTGTTGCTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137264042 Original CRISPR ACTGGTGTTGTTGCTCACTG AGG Intergenic
No off target data available for this crispr